ID: 914045102

View in Genome Browser
Species Human (GRCh38)
Location 1:144084720-144084742
Sequence CTTTGAAACAATTGACTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914045100_914045102 -9 Left 914045100 1:144084706-144084728 CCTTTGTCATCCTACTTTGAAAC No data
Right 914045102 1:144084720-144084742 CTTTGAAACAATTGACTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914045102 Original CRISPR CTTTGAAACAATTGACTATT TGG Intergenic
No off target data available for this crispr