ID: 914045104 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:144084737-144084759 |
| Sequence | ATTTGGGCCTAGATTGATAC AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914045100_914045104 | 8 | Left | 914045100 | 1:144084706-144084728 | CCTTTGTCATCCTACTTTGAAAC | No data | ||
| Right | 914045104 | 1:144084737-144084759 | ATTTGGGCCTAGATTGATACAGG | No data | ||||
| 914045101_914045104 | -2 | Left | 914045101 | 1:144084716-144084738 | CCTACTTTGAAACAATTGACTAT | No data | ||
| Right | 914045104 | 1:144084737-144084759 | ATTTGGGCCTAGATTGATACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914045104 | Original CRISPR | ATTTGGGCCTAGATTGATAC AGG | Intergenic | ||
| No off target data available for this crispr | |||||