ID: 914045104

View in Genome Browser
Species Human (GRCh38)
Location 1:144084737-144084759
Sequence ATTTGGGCCTAGATTGATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914045100_914045104 8 Left 914045100 1:144084706-144084728 CCTTTGTCATCCTACTTTGAAAC No data
Right 914045104 1:144084737-144084759 ATTTGGGCCTAGATTGATACAGG No data
914045101_914045104 -2 Left 914045101 1:144084716-144084738 CCTACTTTGAAACAATTGACTAT No data
Right 914045104 1:144084737-144084759 ATTTGGGCCTAGATTGATACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914045104 Original CRISPR ATTTGGGCCTAGATTGATAC AGG Intergenic
No off target data available for this crispr