ID: 914051947

View in Genome Browser
Species Human (GRCh38)
Location 1:144144696-144144718
Sequence GATTTGCCCTGCCCCAACGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914051947_914051954 24 Left 914051947 1:144144696-144144718 CCAACGTTGGGGCAGGGCAAATC No data
Right 914051954 1:144144743-144144765 CTCTGGCCCTGCCTTGGCCCTGG No data
914051947_914051952 18 Left 914051947 1:144144696-144144718 CCAACGTTGGGGCAGGGCAAATC No data
Right 914051952 1:144144737-144144759 GTCCATCTCTGGCCCTGCCTTGG No data
914051947_914051950 7 Left 914051947 1:144144696-144144718 CCAACGTTGGGGCAGGGCAAATC No data
Right 914051950 1:144144726-144144748 GACATCTCCAAGTCCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914051947 Original CRISPR GATTTGCCCTGCCCCAACGT TGG (reversed) Intergenic
No off target data available for this crispr