ID: 914051949

View in Genome Browser
Species Human (GRCh38)
Location 1:144144722-144144744
Sequence AGATGGACTTGGAGATGTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914051949_914051954 -2 Left 914051949 1:144144722-144144744 CCAGGACATCTCCAAGTCCATCT No data
Right 914051954 1:144144743-144144765 CTCTGGCCCTGCCTTGGCCCTGG No data
914051949_914051958 9 Left 914051949 1:144144722-144144744 CCAGGACATCTCCAAGTCCATCT No data
Right 914051958 1:144144754-144144776 CCTTGGCCCTGGCCCCTTCCTGG No data
914051949_914051964 26 Left 914051949 1:144144722-144144744 CCAGGACATCTCCAAGTCCATCT No data
Right 914051964 1:144144771-144144793 TCCTGGCCTGACCTTGTCCCTGG No data
914051949_914051952 -8 Left 914051949 1:144144722-144144744 CCAGGACATCTCCAAGTCCATCT No data
Right 914051952 1:144144737-144144759 GTCCATCTCTGGCCCTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914051949 Original CRISPR AGATGGACTTGGAGATGTCC TGG (reversed) Intergenic
No off target data available for this crispr