ID: 914051950

View in Genome Browser
Species Human (GRCh38)
Location 1:144144726-144144748
Sequence GACATCTCCAAGTCCATCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914051947_914051950 7 Left 914051947 1:144144696-144144718 CCAACGTTGGGGCAGGGCAAATC No data
Right 914051950 1:144144726-144144748 GACATCTCCAAGTCCATCTCTGG No data
914051941_914051950 23 Left 914051941 1:144144680-144144702 CCAGAGCAGGGCTGGACCAACGT No data
Right 914051950 1:144144726-144144748 GACATCTCCAAGTCCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914051950 Original CRISPR GACATCTCCAAGTCCATCTC TGG Intergenic
No off target data available for this crispr