ID: 914051954

View in Genome Browser
Species Human (GRCh38)
Location 1:144144743-144144765
Sequence CTCTGGCCCTGCCTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914051949_914051954 -2 Left 914051949 1:144144722-144144744 CCAGGACATCTCCAAGTCCATCT No data
Right 914051954 1:144144743-144144765 CTCTGGCCCTGCCTTGGCCCTGG No data
914051947_914051954 24 Left 914051947 1:144144696-144144718 CCAACGTTGGGGCAGGGCAAATC No data
Right 914051954 1:144144743-144144765 CTCTGGCCCTGCCTTGGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914051954 Original CRISPR CTCTGGCCCTGCCTTGGCCC TGG Intergenic
No off target data available for this crispr