ID: 914054399

View in Genome Browser
Species Human (GRCh38)
Location 1:144158090-144158112
Sequence GCTCCTGGCAAGGCACAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 7, 1: 0, 2: 3, 3: 11, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914054399_914054405 15 Left 914054399 1:144158090-144158112 CCTGGTTGTGCCTTGCCAGGAGC 0: 7
1: 0
2: 3
3: 11
4: 127
Right 914054405 1:144158128-144158150 TGAGAGTGTCATGAGCGCAGCGG 0: 4
1: 2
2: 0
3: 15
4: 170
914054399_914054406 18 Left 914054399 1:144158090-144158112 CCTGGTTGTGCCTTGCCAGGAGC 0: 7
1: 0
2: 3
3: 11
4: 127
Right 914054406 1:144158131-144158153 GAGTGTCATGAGCGCAGCGGTGG 0: 4
1: 2
2: 1
3: 3
4: 70
914054399_914054407 29 Left 914054399 1:144158090-144158112 CCTGGTTGTGCCTTGCCAGGAGC 0: 7
1: 0
2: 3
3: 11
4: 127
Right 914054407 1:144158142-144158164 GCGCAGCGGTGGTAGTTGTGTGG 0: 4
1: 2
2: 1
3: 3
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914054399 Original CRISPR GCTCCTGGCAAGGCACAACC AGG (reversed) Intergenic
901056113 1:6449269-6449291 GGTCCTGCCAAAGCACGACCGGG + Intronic
902549753 1:17212267-17212289 GCTCCTGGCAGGCCAGATCCTGG + Intronic
902628563 1:17690842-17690864 GCTTCTGCAAAGGCACAACGTGG - Intronic
903135871 1:21308840-21308862 GCTCCTAGCAAGGGAAACCCTGG - Intronic
904624750 1:31796163-31796185 GCTCCAGGCAGGGAACCACCCGG - Intronic
911102313 1:94104494-94104516 GTTCAGGGAAAGGCACAACCTGG - Intronic
911171684 1:94776637-94776659 TCTCCTGTGAAGGCAGAACCTGG - Intergenic
912315672 1:108665788-108665810 GATCCTGGCAGGGCAGATCCAGG - Intergenic
913960044 1:143332517-143332539 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914054399 1:144158090-144158112 GCTCCTGGCAAGGCACAACCAGG - Intergenic
914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG + Intergenic
918097183 1:181345172-181345194 GCTCCTTGGAAGGCAAAGCCAGG + Intergenic
923459353 1:234195196-234195218 GCTCCTAGGTAGGCACAGCCTGG - Intronic
923525927 1:234772749-234772771 GCTCGTGTCAACGCAAAACCAGG - Intergenic
1063135009 10:3208699-3208721 GCTCAGGGTGAGGCACAACCAGG - Intergenic
1067028450 10:42864569-42864591 GCTCCTGGCAAGGCACAACCAGG - Intergenic
1067731352 10:48813983-48814005 GCTCCTGCAGAGGCACCACCAGG + Exonic
1071178554 10:82956103-82956125 GCTCCTGGGAAGGCAGACCCTGG - Intronic
1071386144 10:85123421-85123443 GCTCCTGTCTAGGAACAGCCTGG - Intergenic
1075360616 10:121829461-121829483 GCTCCTGGCAAGGCCGAGGCAGG + Intronic
1075477594 10:122749880-122749902 GCTACTGGGAAGGCACAAAGAGG - Intergenic
1076336782 10:129712200-129712222 GGTCCTGCCAAGGCAGGACCAGG + Intronic
1076884335 10:133254745-133254767 GCTCCTGGCCAGGCAATCCCAGG - Intergenic
1078350741 11:10591196-10591218 GCTCCTGGTATGGCACAGCAGGG - Intronic
1080895974 11:36449089-36449111 GCTCCTGGCAAGGAAGAACATGG - Intronic
1081663953 11:44905649-44905671 GCTGCTTGCCAGGCACAGCCGGG - Intronic
1083301245 11:61740601-61740623 GCTCCCGGCAGGGTACCACCAGG + Intronic
1083822703 11:65181934-65181956 GCTCAGGGCAGGGCCCAACCAGG - Intronic
1089315702 11:117589661-117589683 GCTCTTTGCAACTCACAACCTGG - Intronic
1089461507 11:118656834-118656856 CCTCCTGGCAGAGCACAACTGGG + Exonic
1090334556 11:125953994-125954016 GCTCCTGTCAAGAGACAGCCTGG - Intergenic
1091676160 12:2491680-2491702 GCTGCTGGGAAGACACAATCGGG + Intronic
1091973117 12:4804731-4804753 GCTCCTGGAAACCAACAACCAGG - Intronic
1092540874 12:9419162-9419184 GCCCCCGGCCAGGCACACCCAGG - Intergenic
1092884513 12:12913425-12913447 TCTCCTGACAAGGAGCAACCGGG - Exonic
1094437715 12:30439839-30439861 GCTCCAGGCAAAGTATAACCTGG - Intergenic
1096580652 12:52582684-52582706 GGCACTGGCAAGGCACAGCCAGG - Intergenic
1103945399 12:124523352-124523374 GCTCCTGGGAACCCACACCCCGG + Intronic
1105579732 13:21683945-21683967 GCTCCTGGCAAAGCAGATCCAGG - Intronic
1105797829 13:23873859-23873881 GCTGCTGGGAAGGCACGTCCTGG + Intronic
1108740664 13:53334680-53334702 TCTCCTGTCAAGGCAAAACATGG + Intergenic
1117658351 14:57979477-57979499 GCTCAAGACAAGGCACTACCAGG - Intronic
1117787079 14:59297175-59297197 ACTCCTGGCATGGCACAGCCAGG + Intronic
1122080401 14:99263090-99263112 GACCCTGGGAAGGCACAGCCAGG + Intronic
1125970022 15:43904010-43904032 GCACCTGGGAAGGCACACCGAGG + Intronic
1127485787 15:59416423-59416445 ACTACTGGTTAGGCACAACCTGG - Intronic
1131435165 15:92416376-92416398 GCTCCAGTCACAGCACAACCTGG - Intronic
1133818758 16:9218012-9218034 GCTCCTTGCAAGGCTGAAGCAGG - Intergenic
1134901522 16:17942362-17942384 GCTCCTGACAGGGCACAAACTGG + Intergenic
1138496584 16:57412700-57412722 GCTCCAGGCAGGGCAGCACCTGG - Intronic
1144768919 17:17748270-17748292 GCCCCTGGCATGGCACTACCTGG - Intronic
1144862674 17:18315330-18315352 GCTCCTAGGACGCCACAACCCGG - Exonic
1146429137 17:32774005-32774027 CAGCCTGGCAAGGCACAGCCTGG - Intronic
1147374962 17:40017839-40017861 GCCCCTGGCCAGGCACCAGCTGG - Intergenic
1148389481 17:47260630-47260652 GCTCCAGCAAAGGCTCAACCTGG - Intronic
1148547418 17:48528795-48528817 GCCCCCAGCAAGCCACAACCAGG - Exonic
1152472401 17:80497305-80497327 GCTCCTTGCAACTGACAACCTGG + Intergenic
1152587111 17:81194083-81194105 GCTGATTGCAAGGCACAAGCAGG - Exonic
1154057718 18:11027281-11027303 GCTCCAGTCAAGGTATAACCGGG + Intronic
1154131180 18:11738271-11738293 GCTCCTGCCCAAGCACAGCCTGG + Intronic
1155182052 18:23356387-23356409 GGTCCTGGCAGGGCCCAAGCTGG + Intronic
1155399287 18:25420318-25420340 CCTCCTCTCAAGGCACACCCTGG - Intergenic
1159793127 18:72808909-72808931 GCTCCTGGCAAGGCACCACTTGG - Intronic
1160261222 18:77295979-77296001 GCTGCAAGCAAGGCAAAACCAGG + Intergenic
1160451240 18:78967343-78967365 GCTGATGGCAAGACAGAACCGGG + Intergenic
1160488740 18:79319084-79319106 CCTCCAGTGAAGGCACAACCAGG - Intronic
1160666051 19:329165-329187 GCTCCTGCCCAGACTCAACCTGG + Intronic
1160873490 19:1287109-1287131 GGTCCGGGCCAGGCACAACGTGG + Intronic
1161591409 19:5130873-5130895 GCACCTGGCCAGGCACCCCCAGG - Intronic
1161711947 19:5853754-5853776 GCTCCTTGCCAGGCAGAGCCAGG + Intergenic
1163604122 19:18264929-18264951 CCTCCTGGCAGGGCACCGCCTGG + Exonic
1165649855 19:37476819-37476841 GCTCCTGGGAAGGCTGAATCAGG - Intronic
1165844032 19:38806635-38806657 GATCCTGGGAAGGTACAAACAGG + Intronic
1166617567 19:44264309-44264331 GGTCCTGGGAAGGCAGAACTGGG - Exonic
1202693878 1_KI270712v1_random:110768-110790 GCTCCTGGCAAGGCACAACCAGG - Intergenic
924977942 2:195149-195171 GTTACTGGCCAGGCCCAACCAGG + Intergenic
925620295 2:5785657-5785679 GCTCCTGGACTGGCAAAACCTGG + Intergenic
927003698 2:18825899-18825921 GCTCTCTGCAAAGCACAACCTGG + Intergenic
927187321 2:20491146-20491168 GCTCCTGGCACGGCCCTTCCTGG - Intergenic
927339979 2:21972479-21972501 GCTCCTTGCAAGGAACAAATGGG - Intergenic
927518803 2:23687247-23687269 GCCCCTGGCAGGGCTCACCCAGG - Intronic
928877237 2:36054225-36054247 GCTGCTGGTATGGCAAAACCAGG + Intergenic
929684623 2:44023097-44023119 GCTCCTGGCCAGGCCAAGCCAGG - Intergenic
929916573 2:46141906-46141928 CCTGCTGGCAGGGCAGAACCGGG - Intronic
933952683 2:87343807-87343829 GCTCCTGGCAAGGCACAACCAGG + Intergenic
934236925 2:90240153-90240175 GCTCCTGGCAAGGCACAACCAGG + Intergenic
936023627 2:109014628-109014650 GCTCCAGGCATGGGAAAACCTGG - Intergenic
946143249 2:217709744-217709766 GCTTCTGGCAAAGCCCAGCCAGG - Intronic
946159588 2:217828084-217828106 GGTCCTGGCAAGGCAGGAGCTGG - Intronic
946365345 2:219245571-219245593 ACTCCTGGCAGGGCCCACCCCGG - Intronic
947689918 2:232125724-232125746 GCTCCTGTCAAGGCAAGACTTGG - Intronic
948007584 2:234623189-234623211 GCTCCTGACAAAGCACGCCCTGG + Intergenic
948016226 2:234692929-234692951 GGGCCTGGCAAGGCACATTCAGG + Intergenic
948113194 2:235473437-235473459 GCTGCTGGCAAGGCAGAAGATGG + Intergenic
948911955 2:241009345-241009367 CCTCCAGGCCAGGCACACCCTGG + Intronic
1172544902 20:35752675-35752697 GCTCCTGGCAAAGACCAATCTGG - Intergenic
1172668038 20:36614227-36614249 ACCCCTGGGAAGCCACAACCCGG - Intronic
1178370339 21:32021820-32021842 GCTCCTGGGCAGACACAACCGGG + Intronic
1180041777 21:45283841-45283863 GGTCCTGGCAGGGAACAGCCTGG - Intronic
1180181151 21:46119222-46119244 CCTGCTGGCAAGGCACAGCCAGG + Intronic
1182153382 22:28047281-28047303 CCTCCTGGCAGGGCAGAAGCAGG - Intronic
1182460994 22:30484042-30484064 GCTCTTGGCATGACCCAACCTGG + Intergenic
1184814164 22:46858023-46858045 GCTCCTGGCGATGCTCAACATGG - Intronic
949563357 3:5222821-5222843 GCTCCTGGCAAGCCAGAAGCAGG - Intergenic
950480001 3:13238224-13238246 GGTCCTGGCAAGACACATGCAGG + Intergenic
951143325 3:19195150-19195172 ACTCCTGGCAAGCCTCAAGCTGG - Intronic
952968953 3:38638536-38638558 GCTCCTGGCCTGGCAAGACCAGG + Intronic
953388818 3:42522847-42522869 GATCCTAGCTAGGCACAAGCGGG + Intronic
961634029 3:128321676-128321698 GCTCCTGGGAAGGCCCTTCCTGG - Intronic
970355351 4:15245613-15245635 GCTCCTGGCAAGGAAGAGCCTGG - Intergenic
973138223 4:46733143-46733165 GATCCTCTCAAGGCACAACTTGG - Intergenic
976629121 4:87219818-87219840 GCTCCCGGGAAGGCACCTCCAGG + Intronic
979787993 4:124740711-124740733 GCCCCTGGCATGCCACACCCTGG - Intergenic
981738435 4:147977309-147977331 GCTCCAGGGAAGGCACCATCAGG + Intronic
984877677 4:184384354-184384376 GATCCTTCCACGGCACAACCCGG + Intergenic
990325886 5:54674937-54674959 GTTCCAGGCAAGGAACAGCCGGG + Intergenic
990560861 5:56981479-56981501 GCACTTGGCATGGCACAAGCAGG - Intergenic
995322300 5:110849847-110849869 ACTCCTGGCAAAGAACAGCCTGG - Intergenic
1000940694 5:167356537-167356559 GGTTCTGGCAAGGCATACCCAGG - Intronic
1001466896 5:171975382-171975404 GCTGCTGGCCAGCCACAGCCTGG + Intronic
1001923602 5:175619764-175619786 GCACTTGGCAAGCCACAAGCAGG + Intergenic
1002592785 5:180302830-180302852 GCTCTCGGCAAGGCACAAATGGG - Intronic
1003867657 6:10378224-10378246 GGTCCAGGCAAGGCAGAACAGGG + Intergenic
1008476432 6:51939825-51939847 GCTCCTTGCCAGGCCCAGCCAGG + Intronic
1010577029 6:77544411-77544433 GCTCCTGACAATCCACATCCAGG + Intergenic
1015862115 6:137691978-137692000 TCTCCTGCAAAGTCACAACCAGG - Intergenic
1017812611 6:157994885-157994907 GCTCCTGGCCAGGAACCCCCTGG - Intronic
1018754334 6:166836877-166836899 GCTCCTGACAAGACAAATCCCGG - Intronic
1020794116 7:12661237-12661259 GCTCCTGGCCAGGCTGAGCCAGG + Intergenic
1024628103 7:51225583-51225605 GTTCCTGCCAGGGCACACCCAGG - Intronic
1033010534 7:137617653-137617675 ACTCCTGACAAGGGACCACCAGG + Intronic
1036785060 8:11680446-11680468 GTTCCTGGCAAGGCCGAAGCCGG + Intronic
1037892178 8:22629217-22629239 GGCCCTGGCAAGGCACTGCCTGG + Intronic
1038103433 8:24406500-24406522 GATCTTGGCAAGGCATATCCTGG - Intergenic
1038236702 8:25765730-25765752 GCTCCTGAAAAGGCACAGCCAGG - Intergenic
1041391051 8:57347684-57347706 GCTCCTGGCTAGGCTCTGCCAGG + Intergenic
1046753214 8:117946524-117946546 GGGCCTGCCAAGACACAACCAGG + Intronic
1047521444 8:125598367-125598389 GCCCCTGCCCAGGCACAGCCTGG + Intergenic
1048181953 8:132203351-132203373 GCTCCTGTCAAGGAAGACCCTGG + Intronic
1051176232 9:14363219-14363241 ACTCCTGGCAAGTCACCACTGGG + Intronic
1053451809 9:38199844-38199866 GCTCCTCACAAGGCACAACCAGG - Intergenic
1060074136 9:120576827-120576849 GCTCTTAGCAAGGCAGAAGCAGG + Intronic
1061962532 9:133995318-133995340 GCACCAGGCAGGGCACACCCGGG + Intergenic
1187143818 X:16619560-16619582 GCTCCAGGCATGGCACAACCAGG - Intronic
1189259604 X:39669106-39669128 GAACCAGGCAAGGCACAATCTGG - Intergenic
1190331327 X:49237223-49237245 GCTCATGGCCAGGCGGAACCGGG - Exonic
1191942879 X:66499366-66499388 GCTGCAGGCAGGGCACCACCTGG - Intergenic
1196008117 X:110856828-110856850 GCTCCTTACAAGGCACAGCTGGG - Intergenic