ID: 914057956

View in Genome Browser
Species Human (GRCh38)
Location 1:144182631-144182653
Sequence AAAAATAAGGAAAGGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3075
Summary {0: 5, 1: 0, 2: 22, 3: 264, 4: 2784}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914057956 Original CRISPR AAAAATAAGGAAAGGGAGGC TGG (reversed) Intergenic
Too many off-targets to display for this crispr