ID: 914062620

View in Genome Browser
Species Human (GRCh38)
Location 1:144219975-144219997
Sequence ATGTTGTCATTGTTCAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 7, 1: 0, 2: 1, 3: 20, 4: 229}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914062619_914062620 9 Left 914062619 1:144219943-144219965 CCTCTGGAGTTCTTGTGATGGCA 0: 7
1: 0
2: 0
3: 16
4: 203
Right 914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG 0: 7
1: 0
2: 1
3: 20
4: 229
914062615_914062620 23 Left 914062615 1:144219929-144219951 CCTGGAGCCACCTTCCTCTGGAG 0: 6
1: 1
2: 3
3: 23
4: 258
Right 914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG 0: 7
1: 0
2: 1
3: 20
4: 229
914062616_914062620 16 Left 914062616 1:144219936-144219958 CCACCTTCCTCTGGAGTTCTTGT 0: 7
1: 0
2: 6
3: 35
4: 351
Right 914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG 0: 7
1: 0
2: 1
3: 20
4: 229
914062617_914062620 13 Left 914062617 1:144219939-144219961 CCTTCCTCTGGAGTTCTTGTGAT 0: 7
1: 0
2: 1
3: 34
4: 275
Right 914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG 0: 7
1: 0
2: 1
3: 20
4: 229
914062614_914062620 24 Left 914062614 1:144219928-144219950 CCCTGGAGCCACCTTCCTCTGGA 0: 6
1: 1
2: 2
3: 28
4: 272
Right 914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG 0: 7
1: 0
2: 1
3: 20
4: 229

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914062620 Original CRISPR ATGTTGTCATTGTTCAAGCC AGG Intergenic
902281909 1:15381007-15381029 CTGTTGTCATTTTTCACCCCCGG + Intronic
902741893 1:18444634-18444656 AAGTCCTCATTGCTCAAGCCAGG - Intergenic
903250336 1:22048789-22048811 ATGCTGTGATTGGCCAAGCCTGG + Intergenic
904994424 1:34620058-34620080 ATGTTTTCTTTGTTGAAGACTGG - Intergenic
906137452 1:43509430-43509452 CTGATGATATTGTTCAAGCCAGG - Intergenic
907386915 1:54131960-54131982 ATGGTGTCAGTGTTGAAGGCTGG - Intergenic
907781592 1:57571993-57572015 ATGTTGTGAATGTTCAAGCATGG + Intronic
909349410 1:74632679-74632701 ATGTTATTTTTGTTTAAGCCCGG - Intronic
909992681 1:82242049-82242071 ATGCTGTCCTTGTTCAATCCTGG + Intergenic
912614852 1:111088249-111088271 ATTTCTTCATGGTTCAAGCCTGG + Intergenic
913053625 1:115138280-115138302 GTGATGTCATTCGTCAAGCCAGG - Intergenic
913531161 1:119735291-119735313 GTGTTGTCATTCAGCAAGCCTGG - Exonic
913968241 1:143394383-143394405 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
914062620 1:144219975-144219997 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
914116530 1:144746379-144746401 ATGTTGTCATTGTTCAAGCCAGG - Intergenic
915337257 1:155152276-155152298 ATGTCTTCATGGTTCAATCCTGG - Intergenic
915750146 1:158199515-158199537 ATCTTATCAATGTTCAATCCTGG - Intergenic
916006536 1:160666155-160666177 ATGTTGTCATTATTAAACCTAGG + Intergenic
916261603 1:162847861-162847883 TTGTTTTCATTGTTTAACCCAGG + Intronic
916421319 1:164640345-164640367 ATGTTTTCATCATTCTAGCCGGG - Intronic
918854299 1:189730483-189730505 ATGTTGTCATTGTTAAATTTAGG - Intergenic
921666064 1:217872716-217872738 ATTTTGTCATTTTTGAAGCCTGG + Intergenic
924264879 1:242271102-242271124 ATATGGCCATTGTTGAAGCCTGG + Intronic
1066719932 10:38327380-38327402 ATATGGCCATTGTTGAAGCCTGG - Intergenic
1069140119 10:64811821-64811843 CTGTTGTCATTGCTCAAGGAAGG + Intergenic
1069469119 10:68670822-68670844 ATGTTTTCACTGTGAAAGCCTGG - Intronic
1069558153 10:69411327-69411349 AAGCTGTCCTTGTTCATGCCTGG + Intronic
1069696404 10:70388863-70388885 AAGCTGTCCTTGTTCATGCCTGG + Intergenic
1069761067 10:70811874-70811896 TTGTTGTAACTGTCCAAGCCTGG - Intergenic
1073047521 10:100649026-100649048 ATGTTGTGATCATTCAAACCCGG - Intergenic
1073355654 10:102851869-102851891 ATGTGGTTATTGTGCAGGCCGGG + Intergenic
1074777896 10:116779594-116779616 CTGTTGTCTTTGTTCGGGCCTGG - Intergenic
1075563559 10:123486577-123486599 ATGTTCTTAGTTTTCAAGCCTGG + Intergenic
1078475996 11:11630677-11630699 ATGTTGTCATTTATCGAGACTGG - Intergenic
1085093590 11:73740306-73740328 ATCTAGTCATTGTTCCATCCTGG + Intronic
1086251268 11:84817412-84817434 ATGTTGTTGTTTTTCAATCCAGG + Intronic
1086374406 11:86185595-86185617 ATGAGGGTATTGTTCAAGCCAGG + Intergenic
1091069680 11:132551330-132551352 AAGCTGTCCTTGTTCATGCCTGG + Intronic
1093934501 12:24986343-24986365 ATGTTTTTATTTTTCCAGCCTGG - Intergenic
1096186919 12:49587493-49587515 ATGAGGTCATTGTTAAAGCCTGG + Exonic
1096342281 12:50811109-50811131 GAGTTGTCATTGCTCATGCCTGG + Intronic
1099706878 12:86165907-86165929 ATGTTGACATTGATGAAGCCAGG - Intronic
1099770712 12:87051044-87051066 ATGTTGTCTTTGTTCAATATGGG - Intergenic
1100688535 12:97013093-97013115 ATGTACTGATTGGTCAAGCCTGG + Intergenic
1102503477 12:113369030-113369052 TTGTTTTCATAGTTTAAGCCTGG + Intronic
1102816679 12:115871545-115871567 GTGTTGTCATTGTTCCAGGTTGG + Intergenic
1103243177 12:119432031-119432053 AAGCTGTCATTGTTCATTCCTGG - Intronic
1104128260 12:125868013-125868035 AAGTTGTCCTTGTTCATTCCTGG - Intergenic
1104156655 12:126139542-126139564 ATGGTGTCATTGTTGAAGAGTGG - Intergenic
1104197439 12:126554484-126554506 AAGCTGTCATTGTTCATTCCTGG - Intergenic
1105250685 13:18696865-18696887 AAGCTGTCCTTGTTCATGCCTGG - Intergenic
1108969725 13:56358310-56358332 ATGTTCTCCTTGTTAAAGTCTGG + Intergenic
1109419820 13:62097312-62097334 TTGTTGAAATTGTTCAAGTCAGG + Intergenic
1109768574 13:66937985-66938007 ATGATGTATTTATTCAAGCCAGG - Intronic
1111516971 13:89346834-89346856 GTGTTGTATTTGTGCAAGCCTGG + Intergenic
1112592491 13:100776451-100776473 AAGTTGTCTTTGTTCATTCCTGG + Intergenic
1113192114 13:107760709-107760731 ATGTTGTCATAATTCTAGCAAGG + Intronic
1113560578 13:111276687-111276709 ATGTTGTGATTCTTCAAGAGGGG + Intronic
1113824936 13:113245038-113245060 ATGTTGTCAAAGCTCAAGCATGG + Exonic
1114422290 14:22594445-22594467 AGGTTGTCCTTGTTCATTCCTGG - Intergenic
1115203892 14:30880713-30880735 ATGTGGGCCTTGTTCAAGCCAGG + Exonic
1116596203 14:46849022-46849044 ATTTTGTCATTGATAAAGCAAGG + Intronic
1117432896 14:55687130-55687152 TTGTTGACATTATTAAAGCCAGG + Intronic
1118123589 14:62873927-62873949 ATGATGTCATGTTGCAAGCCTGG - Intronic
1119000264 14:70875447-70875469 AAGTTGTCCTTGTTCATTCCTGG - Intergenic
1119823710 14:77640273-77640295 AAGTTGTCCTTGTTCATTCCTGG + Intergenic
1121631239 14:95423257-95423279 ATATTGTCATTACTCAAGCAAGG + Intronic
1123816411 15:23983840-23983862 AAGTTGTCCTTGTTCAATCATGG - Intergenic
1125041367 15:35190798-35190820 AAGTTGTCCTTGTTCATTCCAGG - Intergenic
1126708066 15:51425808-51425830 AAGCTGTCATTGTTCATTCCTGG + Intergenic
1127506175 15:59599963-59599985 AAGTTGTCCTTGTTCATTCCTGG - Intronic
1128076582 15:64830299-64830321 ATCTTGTCATTCTGGAAGCCAGG - Intergenic
1130073639 15:80670384-80670406 ATGTTGTCTTTGGTCAAGCCTGG + Intergenic
1130085329 15:80773866-80773888 AGGTTGTCATTGTGCTAGTCTGG + Intergenic
1131306717 15:91251505-91251527 ATGTTGTAATTTTTTAAGCAAGG - Intronic
1132150911 15:99457932-99457954 ATGTTCTCTTTGTTCAAACTGGG - Intergenic
1133312257 16:4856546-4856568 ATATGGTCATTGTTTAAGTCTGG + Intronic
1133813455 16:9178687-9178709 ATGTTGAAATTGTTTTAGCCGGG - Intergenic
1134218792 16:12337345-12337367 TTGTTGTTGTTGTTCAAGACAGG + Intronic
1137937055 16:52644848-52644870 ATGTTCTGATTGTTCAGACCTGG - Intergenic
1138066963 16:53952206-53952228 AGGTTGTCAGTGGTCAAGCCAGG + Intronic
1139335340 16:66227176-66227198 AGGTTGTCATGGTTCAAGAATGG + Intergenic
1143222203 17:5272039-5272061 AAGCTGTCATTGTTCATTCCTGG + Intergenic
1143895874 17:10135790-10135812 ATGTTTTCAATGCTCAGGCCTGG + Intronic
1146956534 17:36939352-36939374 TTGTGGTCATAGTTCAAACCAGG + Intronic
1148768323 17:50052426-50052448 ACATTGTCATTGTTCCAGCTGGG + Intergenic
1149265975 17:54928018-54928040 ATCTTGACATTGTTCTAGCAAGG + Intronic
1149732277 17:58958123-58958145 TTGTTGTCATTGTTTGAGACAGG - Intronic
1151663177 17:75530455-75530477 ATGTTTTCACTGTGCTAGCCAGG - Intronic
1153414899 18:4835871-4835893 ATGTTGTGGGTGTTCATGCCCGG - Intergenic
1154171905 18:12058550-12058572 ATGTTTTCATGGTTCAACCTAGG - Intergenic
1154175395 18:12084569-12084591 ATGTTTTCATGGTTCAACCTAGG + Intergenic
1154416060 18:14176293-14176315 ATGTTTTCACTGTTCAACCTAGG - Intergenic
1155638430 18:27983112-27983134 ATATTGTCATTTTTAAAGCCTGG + Intronic
1156970079 18:43143840-43143862 AGTTTGTCATTGATAAAGCCAGG - Intergenic
1157709233 18:49837883-49837905 ATGGTATCATTGCTAAAGCCCGG - Intronic
1159200461 18:65177166-65177188 ATGTTTTCATTGTTCCAGTAGGG + Intergenic
1159655210 18:71024781-71024803 ATGCTGTCTTTGTTCATTCCTGG + Intergenic
1163061528 19:14765324-14765346 ATGGTGTTATTGGCCAAGCCTGG + Exonic
1165122389 19:33568631-33568653 AAGTTGTCCTTGTTCATTCCTGG + Intergenic
1202702028 1_KI270712v1_random:171847-171869 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
924963989 2:58721-58743 ATGTTGACTTTGTTCCAACCTGG + Intergenic
926081599 2:9991022-9991044 GTGTTGTCATTTTTCAAGACTGG - Intronic
928193604 2:29196392-29196414 ATGTTGTTATTTCTCCAGCCAGG + Intronic
928214876 2:29352892-29352914 AAGCTGTCATTGTTCATTCCTGG + Intronic
928420231 2:31132660-31132682 AAGCTGTCTTTGTTCAATCCTGG + Intronic
929550800 2:42890384-42890406 AAGTTGTCGTTGTTCATTCCTGG + Intergenic
930755146 2:54965979-54966001 ATGCTGTCCTTGTTCATTCCTGG - Intronic
932017266 2:68043828-68043850 ATGTTTTCATTGTGAAAGACTGG + Intronic
932530521 2:72525482-72525504 TTGTTGTTGTTGTTCTAGCCAGG - Intronic
932782033 2:74565288-74565310 ATGATGTCATTGTTCTGGCATGG - Intronic
932783289 2:74577436-74577458 TTGTTATCACTATTCAAGCCAGG - Intronic
934155869 2:89199795-89199817 AAGTTGTCCTTGTTCATTCCTGG + Intergenic
934172940 2:89555297-89555319 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
934211453 2:89982964-89982986 AAGTTGTCCTTGTTCATTCCTGG - Intergenic
934283254 2:91629654-91629676 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
935981776 2:108635089-108635111 ATGGACTCATTGTTCAAGTCAGG - Intronic
937822346 2:126325144-126325166 ATGCTGACATTGTACAAGCCAGG + Intergenic
941008136 2:160268651-160268673 ATGTTTTCATTGTTGAAAACTGG + Intronic
941669500 2:168277180-168277202 GTGTTTACATTGTTCAAGCAAGG + Intergenic
941863414 2:170308778-170308800 ATGTTGTCTTTCTTGAAGGCTGG - Intronic
942531426 2:176914443-176914465 TTGATGTAATTGTGCAAGCCAGG - Intergenic
943039894 2:182791628-182791650 AAGTAGTCATTGTTGGAGCCAGG - Exonic
943862718 2:192889241-192889263 AAGCTGTCATTGTTCATTCCTGG - Intergenic
944540039 2:200745969-200745991 ATGTTTCTATTGTTCAGGCCAGG - Intergenic
945172663 2:207012949-207012971 AAGTTGTCCTTGTTCATTCCTGG - Intergenic
946902478 2:224385431-224385453 ATGTTGTCATTCTTCAGAGCTGG + Intronic
947819550 2:233060485-233060507 ATGTTGCCATGGTTCCAGCAGGG - Exonic
1169115813 20:3065061-3065083 ACGCTGTCCTTGTTCAATCCTGG - Intergenic
1169218664 20:3807921-3807943 ATGCGGGCATTGGTCAAGCCAGG + Intergenic
1169929405 20:10816194-10816216 ATGTTCTCATTGGCCAGGCCTGG - Intergenic
1172270298 20:33651495-33651517 ATCTTGTCATTGTTCTAGGTGGG - Intergenic
1174118791 20:48246915-48246937 ACGCTCTCATTGTTCATGCCAGG - Intergenic
1174754519 20:53144384-53144406 AAGCTGTCATTGTTCATTCCTGG - Intronic
1175536480 20:59718213-59718235 AAGTTGTCATTCTCCAAGCAGGG - Intronic
1176420157 21:6507680-6507702 AGGCTGTCTTTGTTCATGCCTGG - Intergenic
1176857282 21:13983002-13983024 ATGTTTTCACTGTTCAAACTAGG + Intergenic
1176867328 21:14061229-14061251 ATGTTTTCACTGTTCAAACTAGG - Intergenic
1177702381 21:24655342-24655364 ATCATGCCATTGTTCCAGCCTGG - Intergenic
1179451135 21:41469149-41469171 GTGGTGCCATTTTTCAAGCCAGG - Intronic
1179695649 21:43116000-43116022 AGGCTGTCTTTGTTCATGCCTGG - Intergenic
1181461377 22:23088065-23088087 AAGTTGTCCTTGTTCATTCCTGG - Intronic
1181761406 22:25061292-25061314 ATTTTGTCATATTTCAAGCCTGG + Intronic
1181933398 22:26421440-26421462 ATCATGTCATTGCACAAGCCTGG - Intergenic
1182889419 22:33804678-33804700 TTGTTGTTTTTGTTTAAGCCAGG - Intronic
1184576688 22:45373664-45373686 AAGTTGTCCTTGTTCATTCCTGG - Intronic
951130270 3:19034120-19034142 ATGTCTTCATTGTTCAATCCTGG - Intergenic
951235989 3:20236917-20236939 ATGTTCTCCTTGTGCAAGTCAGG + Intergenic
952108590 3:30096619-30096641 AAGTTGTCTTTGTTCATTCCTGG - Intergenic
953438961 3:42901591-42901613 AAGCTGTCATTGTTCATTCCTGG - Intronic
953992123 3:47492107-47492129 TTGTTGTTGTTGTTCAAGACAGG + Intergenic
954128446 3:48546884-48546906 ATGTTGTCAATGTTCAATGCAGG + Intronic
955925073 3:63996400-63996422 ATGTGGACATTGTTCACGGCTGG - Exonic
956597261 3:70981356-70981378 ACGGTGTCATTTGTCAAGCCTGG - Intronic
957983728 3:87545855-87545877 AAGCTGTCCTTGTTCATGCCTGG + Intergenic
958973079 3:100635058-100635080 ATATTGTCATTGGTGAAGCTGGG - Intronic
960515320 3:118596353-118596375 CTGTTTTTATTGTTCAAACCTGG - Intergenic
960558992 3:119061545-119061567 TGGTTGTCATTGATCATGCCAGG - Intronic
963745083 3:149117641-149117663 ATGTTTGCATTTTTAAAGCCTGG + Intergenic
964710526 3:159667095-159667117 TTGTTCTCATTGTTGAAGCTTGG + Intronic
965760790 3:172073948-172073970 ATGTTGTCCTTTTGGAAGCCAGG + Intronic
969826791 4:9764153-9764175 ATGTTGTCATTGTTCAAGCCAGG + Intergenic
970442703 4:16095667-16095689 AAGTTGTCTTTGTTCATTCCTGG - Intergenic
971504086 4:27347658-27347680 CTGTTACCATTGTTCAAGGCTGG + Intergenic
971633745 4:29030582-29030604 ATTTTGTCATTGGTAAAGCTGGG + Intergenic
971914615 4:32851633-32851655 AAGTTGTCGTTTTTGAAGCCAGG + Intergenic
972152842 4:36116280-36116302 ATGTTGTGACTGTTTAATCCTGG + Intronic
972722060 4:41709809-41709831 ATGTTCTCTTTATTCAAGCTTGG - Intergenic
973581796 4:52351422-52351444 AAGTTGTCCTTGTTCATTCCTGG + Intergenic
974469959 4:62306183-62306205 ATTTTGTCATTGTTCAGTCTTGG - Intergenic
975820877 4:78269125-78269147 CTGTTGACCTTGTTAAAGCCTGG + Intronic
975945447 4:79700520-79700542 ATGTTATCATTGGTAAAGTCAGG - Intergenic
976854404 4:89585992-89586014 ATGTTGTCTTTGTTCTAGCAGGG + Intergenic
977779668 4:100966049-100966071 ATGTTGTTATTGTTCATGACTGG - Intergenic
978383789 4:108159635-108159657 ATTTTGTCATTGTTCACATCTGG - Intronic
978398610 4:108308325-108308347 ATGTTGTCCCTGTTCATTCCTGG - Intergenic
978472913 4:109090891-109090913 ATGTTCCCTTTGTTCAACCCAGG - Intronic
979956017 4:126955206-126955228 CTGTTGTAATTTTACAAGCCAGG + Intergenic
981258215 4:142688603-142688625 AAGTTGTCCTTGTTCATTCCTGG + Intronic
981305743 4:143245331-143245353 AAGGTGTCATTGTTCATTCCTGG + Intergenic
983431300 4:167655104-167655126 TCTTTGTCATTATTCAAGCCTGG + Intergenic
984697042 4:182789654-182789676 ATGTTGTCAATGTGTAAGCTTGG - Intronic
985125300 4:186688006-186688028 ATATAGTCATTGTAGAAGCCTGG - Intronic
985953123 5:3238293-3238315 AAGTTGTCATCCATCAAGCCTGG - Intergenic
986739682 5:10695202-10695224 ATGTTGTCAGTGCTGAAGCCAGG - Intronic
987985988 5:25146572-25146594 ATTTTTTCATGGTTCAATCCTGG - Intergenic
988258592 5:28852377-28852399 AAGTTGCTCTTGTTCAAGCCAGG + Intergenic
989006443 5:36818628-36818650 TTGTTTTCATTCTACAAGCCTGG + Intergenic
990237773 5:53786350-53786372 AAGCTGTCATTGTTCATTCCTGG + Intergenic
997081163 5:130740011-130740033 ATGTTCTCATTGATAAAGCTAGG - Intergenic
997698337 5:135878925-135878947 ATGTTGTCATTGTTCCTGAAGGG + Intronic
999033803 5:148324165-148324187 ATGTTTTCATTTTTCAAGCAAGG - Intronic
1000556497 5:162732872-162732894 CTGTTGTCCTTGTTCATTCCTGG + Intergenic
1003102460 6:3187347-3187369 AAGCTGTCATTGTTCATTCCTGG + Intergenic
1003714030 6:8626125-8626147 GTGTTCTCATTGTTCACACCGGG - Intergenic
1004534946 6:16491486-16491508 ATGTTGGCCATGTTCAAGACAGG + Intronic
1007200162 6:40101053-40101075 AAGCTGTCATTGTTCATTCCTGG + Intergenic
1009352849 6:62704196-62704218 ATTTTTTCATGGTTCAATCCTGG + Intergenic
1010634467 6:78240331-78240353 ATGTTGCAATTGTTTAGGCCAGG + Intergenic
1012835503 6:104260223-104260245 ATGTCATCATTGTTTAAGGCTGG + Intergenic
1013885592 6:114961567-114961589 ATGTTGTCATTTTGCAAATCTGG + Intergenic
1014240470 6:119012509-119012531 ATGTTGTCCTTATACAAGACAGG + Intronic
1015242162 6:131036740-131036762 ATGTTTCTATTGTACAAGCCAGG + Intronic
1016028642 6:139314807-139314829 AAGTTGTCCTTGTTCATTCCTGG + Intergenic
1017921856 6:158879769-158879791 AAGTTGTCCTTGTTCATTCCTGG - Intronic
1018094168 6:160370510-160370532 ATGTTATTATTATTCAAGCTGGG + Intronic
1019281736 7:203802-203824 ATGTTGTTATTTTACAAACCGGG + Intronic
1019635908 7:2075417-2075439 ATGTTCTCTCTGTTCAATCCCGG + Intronic
1019800840 7:3087270-3087292 ATGCTGTCATTGTCCTACCCTGG + Intergenic
1022098651 7:27156370-27156392 CTGTTGACATTGTATAAGCCCGG + Exonic
1023800733 7:43832243-43832265 AAGTTGTCCTTGTTCATTCCTGG + Intergenic
1026130934 7:67620442-67620464 AAGCTGTCCTTGTTCATGCCTGG + Intergenic
1026142929 7:67721633-67721655 AAGCTGTCCTTGTTCATGCCTGG - Intergenic
1029213494 7:98928190-98928212 ATCGTGCCATTGTTCCAGCCTGG + Intronic
1029871296 7:103695746-103695768 CTGCTGTCATTGTTCAACACTGG - Intronic
1030195023 7:106844768-106844790 ATGCTGTCCTTGTTCATTCCTGG - Intergenic
1031406187 7:121390364-121390386 AGGTTGTCCTTGTTCATTCCTGG + Intronic
1031604851 7:123756309-123756331 ATGTCTTCATTGTTCACACCTGG + Intergenic
1033057359 7:138070644-138070666 ATGTTCTCATTGTAGAAGGCAGG - Intronic
1035419643 7:158716987-158717009 GTGTTGTCAGTGTTCCAGACTGG - Intergenic
1035872631 8:3152588-3152610 ATATGGTGATTGCTCAAGCCAGG + Intronic
1035959917 8:4125669-4125691 AAGTTGTCCTTGTTCATTCCTGG + Intronic
1038598305 8:28911225-28911247 GTCTTCTCATTGTACAAGCCTGG - Intronic
1039306522 8:36268945-36268967 AAGTTGTCCTTGTTCATTCCTGG - Intergenic
1039596067 8:38790827-38790849 ATTTTGCCATTGTTCTAGGCAGG + Intronic
1040498535 8:47987885-47987907 AGGCTGTCATTGTTCATTCCTGG - Intergenic
1040883419 8:52233493-52233515 CTGTTGTCATGGTGTAAGCCTGG + Intronic
1041595734 8:59649194-59649216 TTGTTGTAATTGTACAAGCATGG - Intergenic
1041611962 8:59861451-59861473 ATATTGTCATGGTCCAAGACAGG - Intergenic
1041849384 8:62372049-62372071 ATGTTTTCATTGTTTAAACCAGG - Intronic
1043004335 8:74799315-74799337 ATGTTTTCATTCTTTCAGCCAGG - Intronic
1043254366 8:78115238-78115260 ATGTTGCCAAAGTTCAACCCTGG + Intergenic
1045435842 8:102162888-102162910 ATGTTGTCACCGTTCCATCCTGG + Intergenic
1045976212 8:108132834-108132856 ATATTCTGATTGTTCAAGCCAGG + Intergenic
1048070800 8:131018752-131018774 ATGGTGTCAGAATTCAAGCCAGG + Intronic
1051357087 9:16249592-16249614 TTGTTATCATTATTCAAACCTGG + Intronic
1051994825 9:23202237-23202259 ATGTTGTCACAGTTCAATGCTGG + Intergenic
1053343629 9:37361670-37361692 AATTAGTCATTGTTTAAGCCAGG + Intergenic
1054875082 9:70087593-70087615 ATGATCTGATTGGTCAAGCCTGG + Intronic
1056656330 9:88512403-88512425 AAGTTGTCCTTGTTCAATCCTGG - Intergenic
1057435527 9:95036847-95036869 ATCTTGTCAGTCTTCCAGCCTGG + Intronic
1058879573 9:109274744-109274766 ATGTTGTAAAGGTTAAAGCCAGG - Intronic
1059689773 9:116673946-116673968 ATGCTGTCCTTGTTCATTCCTGG + Intronic
1185813132 X:3129008-3129030 TTGTTGTTATTGTTTAAGACAGG - Intergenic
1188666636 X:32830561-32830583 ATGTTTTCATTGTGCAAAACAGG - Intronic
1189483519 X:41411360-41411382 ATGCTGTCTTTGTTCATTCCTGG - Intergenic
1190292446 X:49001669-49001691 ATGTTGTCATTGTTCCTGGGAGG - Intronic
1192338672 X:70243421-70243443 AAGTTGTCCTTGTTCATTCCTGG + Intergenic
1194369174 X:93049329-93049351 ATATTGTCTCTTTTCAAGCCAGG + Intergenic
1194886858 X:99326407-99326429 AAGTTGTCCTTGTTCATTCCTGG - Intergenic
1196227313 X:113181250-113181272 ATGTTCTCTTTATTCTAGCCAGG + Intergenic
1196382448 X:115105802-115105824 ATGTTTTCATTCTTCAGGCTAGG - Intergenic
1196811627 X:119633639-119633661 ATGCTGTCATGGGCCAAGCCAGG - Intronic
1197209654 X:123818323-123818345 AAGTTGTCCTTGTTCATTCCTGG - Intergenic
1199082285 X:143590597-143590619 AAGCTGTCATTGTTCATTCCTGG + Intergenic
1200677380 Y:6165660-6165682 ATATTGTCTCTTTTCAAGCCAGG + Intergenic
1201268472 Y:12231534-12231556 TTGTTGTTATTGTTTAAGACAGG + Intergenic