ID: 914065100 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:144239387-144239409 |
| Sequence | CTGTCTGCACAGTTGGTCCT AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914065100_914065102 | -4 | Left | 914065100 | 1:144239387-144239409 | CCTAGGACCAACTGTGCAGACAG | No data | ||
| Right | 914065102 | 1:144239406-144239428 | ACAGACAGACCCTCCTTCACAGG | 0: 6 1: 0 2: 2 3: 22 4: 168 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914065100 | Original CRISPR | CTGTCTGCACAGTTGGTCCT AGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||