ID: 914065100

View in Genome Browser
Species Human (GRCh38)
Location 1:144239387-144239409
Sequence CTGTCTGCACAGTTGGTCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914065100_914065102 -4 Left 914065100 1:144239387-144239409 CCTAGGACCAACTGTGCAGACAG No data
Right 914065102 1:144239406-144239428 ACAGACAGACCCTCCTTCACAGG 0: 6
1: 0
2: 2
3: 22
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914065100 Original CRISPR CTGTCTGCACAGTTGGTCCT AGG (reversed) Intergenic
No off target data available for this crispr