ID: 914066389

View in Genome Browser
Species Human (GRCh38)
Location 1:144248724-144248746
Sequence TCCGGGGGGGCTCGAGGGTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914066383_914066389 -8 Left 914066383 1:144248709-144248731 CCAGGGAGGGGGTAGTCCGGGGG No data
Right 914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG No data
914066377_914066389 -2 Left 914066377 1:144248703-144248725 CCTGCCCCAGGGAGGGGGTAGTC No data
Right 914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG No data
914066367_914066389 23 Left 914066367 1:144248678-144248700 CCTTGGTTGTGCCACAGGCAGGG No data
Right 914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG No data
914066370_914066389 12 Left 914066370 1:144248689-144248711 CCACAGGCAGGGGTCCTGCCCCA No data
Right 914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG No data
914066381_914066389 -7 Left 914066381 1:144248708-144248730 CCCAGGGAGGGGGTAGTCCGGGG No data
Right 914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG No data
914066365_914066389 24 Left 914066365 1:144248677-144248699 CCCTTGGTTGTGCCACAGGCAGG No data
Right 914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG No data
914066379_914066389 -6 Left 914066379 1:144248707-144248729 CCCCAGGGAGGGGGTAGTCCGGG No data
Right 914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG No data
914066364_914066389 25 Left 914066364 1:144248676-144248698 CCCCTTGGTTGTGCCACAGGCAG No data
Right 914066389 1:144248724-144248746 TCCGGGGGGGCTCGAGGGTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914066389 Original CRISPR TCCGGGGGGGCTCGAGGGTG TGG Intergenic
No off target data available for this crispr