ID: 914081696

View in Genome Browser
Species Human (GRCh38)
Location 1:144415937-144415959
Sequence GGTAAGGGCACCGCCCGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914081683_914081696 24 Left 914081683 1:144415890-144415912 CCGGGTGAGCTAGGGCTCCGAAG No data
Right 914081696 1:144415937-144415959 GGTAAGGGCACCGCCCGTTTAGG No data
914081691_914081696 -2 Left 914081691 1:144415916-144415938 CCAGGCAGGGAGGGACCAGTGGG No data
Right 914081696 1:144415937-144415959 GGTAAGGGCACCGCCCGTTTAGG No data
914081688_914081696 7 Left 914081688 1:144415907-144415929 CCGAAGACACCAGGCAGGGAGGG No data
Right 914081696 1:144415937-144415959 GGTAAGGGCACCGCCCGTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914081696 Original CRISPR GGTAAGGGCACCGCCCGTTT AGG Intergenic
No off target data available for this crispr