ID: 914086884

View in Genome Browser
Species Human (GRCh38)
Location 1:144461668-144461690
Sequence GCCCCGCTGCGCCTGCGCCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 271
Summary {0: 4, 1: 2, 2: 3, 3: 25, 4: 237}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914086884_914086894 23 Left 914086884 1:144461668-144461690 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914086894 1:144461714-144461736 GCGGCACAGCGGGTTCGCGCGGG No data
914086884_914086895 28 Left 914086884 1:144461668-144461690 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914086895 1:144461719-144461741 ACAGCGGGTTCGCGCGGGCCAGG No data
914086884_914086889 12 Left 914086884 1:144461668-144461690 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914086889 1:144461703-144461725 TGGCCGCCTCTGCGGCACAGCGG No data
914086884_914086886 -8 Left 914086884 1:144461668-144461690 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914086886 1:144461683-144461705 AGCGGGGCCTTAAAGGTACATGG No data
914086884_914086893 22 Left 914086884 1:144461668-144461690 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914086893 1:144461713-144461735 TGCGGCACAGCGGGTTCGCGCGG No data
914086884_914086890 13 Left 914086884 1:144461668-144461690 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914086890 1:144461704-144461726 GGCCGCCTCTGCGGCACAGCGGG No data
914086884_914086888 4 Left 914086884 1:144461668-144461690 CCAAGGCGCAGGCGCAGCGGGGC 0: 4
1: 2
2: 3
3: 25
4: 237
Right 914086888 1:144461695-144461717 AAGGTACATGGCCGCCTCTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914086884 Original CRISPR GCCCCGCTGCGCCTGCGCCT TGG (reversed) Intronic