ID: 914089655

View in Genome Browser
Species Human (GRCh38)
Location 1:144485192-144485214
Sequence TGTTGCCATAGCAATTGGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914089650_914089655 -8 Left 914089650 1:144485177-144485199 CCTCAGCGGCTCCACTGTTGCCA No data
Right 914089655 1:144485192-144485214 TGTTGCCATAGCAATTGGGTGGG No data
914089646_914089655 -2 Left 914089646 1:144485171-144485193 CCCCTCCCTCAGCGGCTCCACTG No data
Right 914089655 1:144485192-144485214 TGTTGCCATAGCAATTGGGTGGG No data
914089642_914089655 21 Left 914089642 1:144485148-144485170 CCAGCCAAGTTCTCACGGAGTGG No data
Right 914089655 1:144485192-144485214 TGTTGCCATAGCAATTGGGTGGG No data
914089644_914089655 17 Left 914089644 1:144485152-144485174 CCAAGTTCTCACGGAGTGGCCCC No data
Right 914089655 1:144485192-144485214 TGTTGCCATAGCAATTGGGTGGG No data
914089648_914089655 -4 Left 914089648 1:144485173-144485195 CCTCCCTCAGCGGCTCCACTGTT No data
Right 914089655 1:144485192-144485214 TGTTGCCATAGCAATTGGGTGGG No data
914089649_914089655 -7 Left 914089649 1:144485176-144485198 CCCTCAGCGGCTCCACTGTTGCC No data
Right 914089655 1:144485192-144485214 TGTTGCCATAGCAATTGGGTGGG No data
914089647_914089655 -3 Left 914089647 1:144485172-144485194 CCCTCCCTCAGCGGCTCCACTGT No data
Right 914089655 1:144485192-144485214 TGTTGCCATAGCAATTGGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914089655 Original CRISPR TGTTGCCATAGCAATTGGGT GGG Intergenic
No off target data available for this crispr