ID: 914094347

View in Genome Browser
Species Human (GRCh38)
Location 1:144532084-144532106
Sequence CACCTTTAGAAACATCAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914094347_914094350 30 Left 914094347 1:144532084-144532106 CCCAGCTGATGTTTCTAAAGGTG No data
Right 914094350 1:144532137-144532159 AGCTTGATTTCCCATAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914094347 Original CRISPR CACCTTTAGAAACATCAGCT GGG (reversed) Intergenic
No off target data available for this crispr