ID: 914094932

View in Genome Browser
Species Human (GRCh38)
Location 1:144537096-144537118
Sequence AACAGAATCCTGCACCTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914094932_914094936 2 Left 914094932 1:144537096-144537118 CCTGTTAGGTGCAGGATTCTGTT No data
Right 914094936 1:144537121-144537143 CTCCAATGATGGGTGTCAGATGG No data
914094932_914094934 -9 Left 914094932 1:144537096-144537118 CCTGTTAGGTGCAGGATTCTGTT No data
Right 914094934 1:144537110-144537132 GATTCTGTTGGCTCCAATGATGG No data
914094932_914094938 16 Left 914094932 1:144537096-144537118 CCTGTTAGGTGCAGGATTCTGTT No data
Right 914094938 1:144537135-144537157 GTCAGATGGATTAATTTTTATGG No data
914094932_914094935 -8 Left 914094932 1:144537096-144537118 CCTGTTAGGTGCAGGATTCTGTT No data
Right 914094935 1:144537111-144537133 ATTCTGTTGGCTCCAATGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914094932 Original CRISPR AACAGAATCCTGCACCTAAC AGG (reversed) Intergenic
No off target data available for this crispr