ID: 914099408

View in Genome Browser
Species Human (GRCh38)
Location 1:144570911-144570933
Sequence GGTAAGGGCACCGCCCGTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914099408_914099420 24 Left 914099408 1:144570911-144570933 CCTAAACGGGCGGTGCCCTTACC No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data
914099408_914099415 7 Left 914099408 1:144570911-144570933 CCTAAACGGGCGGTGCCCTTACC No data
Right 914099415 1:144570941-144570963 CCCTCCCTGCCTGCTGTCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914099408 Original CRISPR GGTAAGGGCACCGCCCGTTT AGG (reversed) Intergenic