ID: 914099420

View in Genome Browser
Species Human (GRCh38)
Location 1:144570958-144570980
Sequence CTTCGGAGCCCTAGCTCACC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914099411_914099420 8 Left 914099411 1:144570927-144570949 CCTTACCCACTGGTCCCTCCCTG No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data
914099414_914099420 -6 Left 914099414 1:144570941-144570963 CCCTCCCTGCCTGCTGTCTTCGG No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data
914099410_914099420 9 Left 914099410 1:144570926-144570948 CCCTTACCCACTGGTCCCTCCCT No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data
914099408_914099420 24 Left 914099408 1:144570911-144570933 CCTAAACGGGCGGTGCCCTTACC No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data
914099412_914099420 3 Left 914099412 1:144570932-144570954 CCCACTGGTCCCTCCCTGCCTGC No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data
914099413_914099420 2 Left 914099413 1:144570933-144570955 CCACTGGTCCCTCCCTGCCTGCT No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data
914099416_914099420 -7 Left 914099416 1:144570942-144570964 CCTCCCTGCCTGCTGTCTTCGGA No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data
914099417_914099420 -10 Left 914099417 1:144570945-144570967 CCCTGCCTGCTGTCTTCGGAGCC No data
Right 914099420 1:144570958-144570980 CTTCGGAGCCCTAGCTCACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914099420 Original CRISPR CTTCGGAGCCCTAGCTCACC CGG Intergenic