ID: 914114051

View in Genome Browser
Species Human (GRCh38)
Location 1:144726967-144726989
Sequence CTGTCTGCACAGTTGGTCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914114049_914114051 -4 Left 914114049 1:144726948-144726970 CCTGTGAAGGAGGGTCTGTCTGT 0: 6
1: 0
2: 2
3: 22
4: 168
Right 914114051 1:144726967-144726989 CTGTCTGCACAGTTGGTCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914114051 Original CRISPR CTGTCTGCACAGTTGGTCCT AGG Intergenic
No off target data available for this crispr