ID: 914116530

View in Genome Browser
Species Human (GRCh38)
Location 1:144746379-144746401
Sequence ATGTTGTCATTGTTCAAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914116530_914116535 23 Left 914116530 1:144746379-144746401 CCTGGCTTGAACAATGACAACAT No data
Right 914116535 1:144746425-144746447 CTCCAGAGGAAGGTGGCTCCAGG No data
914116530_914116534 16 Left 914116530 1:144746379-144746401 CCTGGCTTGAACAATGACAACAT No data
Right 914116534 1:144746418-144746440 ACAAGAACTCCAGAGGAAGGTGG No data
914116530_914116531 9 Left 914116530 1:144746379-144746401 CCTGGCTTGAACAATGACAACAT No data
Right 914116531 1:144746411-144746433 TGCCATCACAAGAACTCCAGAGG No data
914116530_914116533 13 Left 914116530 1:144746379-144746401 CCTGGCTTGAACAATGACAACAT No data
Right 914116533 1:144746415-144746437 ATCACAAGAACTCCAGAGGAAGG No data
914116530_914116536 24 Left 914116530 1:144746379-144746401 CCTGGCTTGAACAATGACAACAT No data
Right 914116536 1:144746426-144746448 TCCAGAGGAAGGTGGCTCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914116530 Original CRISPR ATGTTGTCATTGTTCAAGCC AGG (reversed) Intergenic
No off target data available for this crispr