ID: 914124747

View in Genome Browser
Species Human (GRCh38)
Location 1:144808271-144808293
Sequence GCTCCTGGCAAGGCACAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914124741_914124747 15 Left 914124741 1:144808233-144808255 CCGCTGCGCTCATGACACTCTCA No data
Right 914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG No data
914124739_914124747 29 Left 914124739 1:144808219-144808241 CCACACAACTACCACCGCTGCGC No data
Right 914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG No data
914124740_914124747 18 Left 914124740 1:144808230-144808252 CCACCGCTGCGCTCATGACACTC No data
Right 914124747 1:144808271-144808293 GCTCCTGGCAAGGCACAACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914124747 Original CRISPR GCTCCTGGCAAGGCACAACC AGG Intergenic
No off target data available for this crispr