ID: 914133006

View in Genome Browser
Species Human (GRCh38)
Location 1:144875949-144875971
Sequence ATTTGGGCCTAGATTGATAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 3, 1: 3, 2: 12, 3: 5, 4: 70}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914133006_914133010 8 Left 914133006 1:144875949-144875971 CCTGTATCAATCTAGGCCCAAAT 0: 3
1: 3
2: 12
3: 5
4: 70
Right 914133010 1:144875980-144876002 GTTTCAAAGTAGGATGACAAAGG 0: 18
1: 1
2: 1
3: 10
4: 211
914133006_914133009 -2 Left 914133006 1:144875949-144875971 CCTGTATCAATCTAGGCCCAAAT 0: 3
1: 3
2: 12
3: 5
4: 70
Right 914133009 1:144875970-144875992 ATAGTCAATTGTTTCAAAGTAGG 0: 12
1: 8
2: 1
3: 20
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914133006 Original CRISPR ATTTGGGCCTAGATTGATAC AGG (reversed) Intergenic
901409248 1:9071479-9071501 ATCTGGGCCTAGATAGAAGCAGG - Intronic
901484743 1:9551059-9551081 TTGTGGGCCTAGCTTAATACTGG - Intronic
907924061 1:58939764-58939786 ATTGGGGTCTATTTTGATACTGG - Intergenic
908712486 1:67032349-67032371 ATTTGAGGCTATTTTGATACAGG + Intronic
910528445 1:88208369-88208391 ATTTGAGCCTAGATGTGTACGGG + Intergenic
912677029 1:111692147-111692169 ACTTGGTGCTAGATTGATATGGG + Intronic
914045104 1:144084737-144084759 ATTTGGGCCTAGATTGATACAGG + Intergenic
914133006 1:144875949-144875971 ATTTGGGCCTAGATTGATACAGG - Intergenic
1066957221 10:42184420-42184442 ATCTGAGCCTAGATTGATAGAGG + Intergenic
1068581142 10:58741049-58741071 ATTTGGGACCAAATTGAGACGGG + Intronic
1075745385 10:124723959-124723981 ACTTGGGACGAGACTGATACCGG - Intronic
1079499474 11:21086492-21086514 ATTTGGGCTGAGTCTGATACCGG + Intronic
1079936408 11:26622135-26622157 ATTTGGGCCTTGGATGATGCAGG + Intronic
1082583897 11:54909955-54909977 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1092023850 12:5224422-5224444 ATTTGGGGCTACATGGAGACAGG - Intergenic
1094857535 12:34417416-34417438 ATTTGGGCCTACAGTGAAAAAGG - Intergenic
1099042251 12:77670444-77670466 TTTTGGTACTAGAGTGATACTGG - Intergenic
1099965111 12:89437649-89437671 ATATGGGCCTAAATTGCTATGGG - Intronic
1100076848 12:90795458-90795480 ATTTTGGGCAACATTGATACTGG + Intergenic
1111360191 13:87166145-87166167 ATTTGGGCATAGATATATAATGG + Intergenic
1112153972 13:96797260-96797282 ATCTGGGGCTACACTGATACAGG + Intronic
1112202152 13:97287280-97287302 ACTTGGCCCTAGACTGATGCTGG + Intronic
1112285533 13:98100915-98100937 ATTTAGGCATGGATTGATTCTGG - Intergenic
1116265602 14:42685987-42686009 ATTGGTGCCTGGATTGATAAAGG + Intergenic
1116307279 14:43274265-43274287 CTTTGGGCTAAGATTGCTACTGG + Intergenic
1202935883 14_KI270725v1_random:87356-87378 ATTTGAGCCTAGATTGATAGAGG - Intergenic
1124709005 15:31989716-31989738 ATTTGAACTTAGATTGATTCTGG - Intergenic
1126977577 15:54201319-54201341 TTTTGGTACTAGAGTGATACTGG - Intronic
1130298285 15:82662465-82662487 ATTTGGGCCTTGGTTGTTTCAGG - Intronic
1135816929 16:25643262-25643284 AAATGGGCCTGGATTGATATGGG - Intergenic
1139333664 16:66214922-66214944 CTTTGGGCCTAGATGCCTACAGG + Intergenic
1145267835 17:21388964-21388986 CTTGGGGCCTGGATTGACACGGG + Intronic
1147803826 17:43114972-43114994 ATTTTGGCCTAAATAGAAACTGG + Intronic
1151152017 17:72096270-72096292 ATTTGTGCCTAGAATTAGACAGG + Intergenic
1154421627 18:14235359-14235381 ATTTGGGAATATATTGATAATGG + Intergenic
1155304095 18:24462443-24462465 ATTTCTGCCTAGATTGCTGCAGG - Intronic
1155944240 18:31829651-31829673 ATTAGTGCCGAGATTGAGACTGG + Exonic
1156889265 18:42171155-42171177 ATGTGGTCCTAGATTGATACAGG - Intergenic
1165259398 19:34599082-34599104 ATTGGGAGCTAGGTTGATACTGG + Intronic
1202684662 1_KI270712v1_random:38141-38163 ATTTGGGCCTAGATTGATACAGG + Intergenic
932585744 2:73027235-73027257 ATGTAGGCCTAGAATGATATGGG + Intronic
934247057 2:90316705-90316727 ATTTGAGCCTAGATTGATACAGG - Intergenic
934262269 2:91485898-91485920 ATTTGAGCCTAGATTGATACAGG + Intergenic
934305319 2:91816885-91816907 ATTTGAGCCTAGATTGATAGAGG + Intergenic
934327938 2:92035863-92035885 ATTTGAGCCTAGATTGATAGAGG - Intergenic
934466326 2:94266402-94266424 ATTTGAGCCTAGATTGATAGAGG - Intergenic
937828666 2:126396132-126396154 TTTTGGTATTAGATTGATACTGG + Intergenic
940865877 2:158817477-158817499 ATTTGGGGCTAGATGGAGGCAGG + Intronic
942434208 2:175953598-175953620 ATTCAGGAGTAGATTGATACAGG - Intronic
1180280228 22:10687036-10687058 ATTTGAGCCTAGATTGATAGAGG - Intergenic
1180587449 22:16905573-16905595 ATTTGAGCCTAGATTGATACAGG - Intergenic
949118121 3:353996-354018 ATTAGGGCATAGAAAGATACAGG + Intronic
951666952 3:25136897-25136919 AGTTGGGCCAAGATTGTTAATGG + Intergenic
959016423 3:101139211-101139233 ATCTGGGCCTAGAGTGGTAACGG + Intergenic
963095857 3:141539250-141539272 ATTTGTGCCTAGATTTTTAGTGG + Intronic
976483878 4:85577543-85577565 CTTGGAGCCTAGATTGATCCTGG + Intronic
977053425 4:92159593-92159615 ATTTGGGAAAAGATTGATTCTGG - Intergenic
977552870 4:98460530-98460552 ATTTGCGCCTAGATTAAAAGAGG - Intergenic
978150783 4:105431987-105432009 GTTTGGGACTAGATAGATACAGG + Intronic
978202834 4:106043060-106043082 CTTGGGGCTTATATTGATACTGG + Exonic
981795612 4:148591516-148591538 TTTTGGTACTAGGTTGATACTGG + Intergenic
988585542 5:32504635-32504657 AATGGGGCAGAGATTGATACTGG - Intergenic
990512606 5:56502326-56502348 ATTTGTGCCTATATTTAGACTGG - Intergenic
996788211 5:127264092-127264114 ATCTGGGCCTAAATTGAAAAGGG - Intergenic
998682682 5:144487719-144487741 ATTTGGGACAAGATTGATGTGGG - Intergenic
1000176812 5:158764155-158764177 ATTTGGGCCAGGATTCAAACTGG + Intronic
1001768369 5:174272982-174273004 CTTTGGGCCTAGAAGGATACAGG + Intergenic
1002547762 5:179962495-179962517 ATTTGAACCTAGGTTGATATGGG - Intronic
1013425166 6:110005326-110005348 ATTGGGTCCCAGATTGATAAGGG - Intergenic
1017335779 6:153258133-153258155 ATATAGGCCTACATTGAAACTGG + Intergenic
1022605310 7:31807590-31807612 ATTTGGGACTTGATTTATTCTGG + Intronic
1025592086 7:62873970-62873992 ATTTGGGCCTACAGTGAGAAAGG + Intergenic
1028736191 7:94215317-94215339 ATTTGTGCCTAGAAAGCTACTGG - Intergenic
1031358070 7:120813008-120813030 ATTTGGTCTCAGATTGATAGTGG - Intronic
1032996563 7:137453367-137453389 CTTTGGGGCTAGAGTGATAATGG - Intronic
1034586172 7:152094397-152094419 ACTTGGGCCTCGAGTGAAACGGG - Exonic
1044065847 8:87699485-87699507 ATTTGGGCAATGATTGATAGGGG - Intergenic
1048036967 8:130685926-130685948 ATTTGAGCCTTGCTGGATACTGG + Intergenic
1051942874 9:22530096-22530118 ATTTGATCCTAGATTGACATGGG + Intergenic
1053323314 9:37119692-37119714 ATTTGGGCCAAGTTTGATGAGGG - Intergenic
1053696375 9:40643173-40643195 ATTTGAGCCTACATTGATAGAGG - Intergenic
1054307626 9:63442401-63442423 ATTTGAGCCTACATTGATAGAGG - Intergenic
1054406352 9:64766403-64766425 ATTTGAGCCTAGATTGATAGAGG - Intergenic
1054439979 9:65251876-65251898 ATTTGAGCCTAGATTGATAGAGG - Intergenic
1054490426 9:65770063-65770085 ATTTGAGCCTAGATTGATAGAGG + Intergenic
1057064496 9:92036238-92036260 CTGTGGGCCTGGTTTGATACTGG - Intronic
1202778822 9_KI270717v1_random:16834-16856 ATTTGAGCCTAGATTGATAGAGG - Intergenic
1203585897 Un_KI270747v1:3242-3264 ATTTGAGCCTAGATTGATAGAGG - Intergenic
1186662767 X:11685847-11685869 AGTTGGGGCTAGATTGTGACTGG - Intergenic
1188100235 X:26073529-26073551 GATTGGGCTTAGACTGATACAGG + Intergenic
1190362850 X:49665582-49665604 ATTGGGGCCAAGATTGGAACTGG + Intergenic
1199232299 X:145450334-145450356 TTTTGGGCCTAGATTGGGTCAGG + Intergenic
1201194120 Y:11475106-11475128 ATTTGAGCCTAGATTGATAGAGG - Intergenic