ID: 914137484

View in Genome Browser
Species Human (GRCh38)
Location 1:144914374-144914396
Sequence GGTCCCTGGTTTGCTGCTAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 3, 1: 0, 2: 0, 3: 6, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914137481_914137484 -6 Left 914137481 1:144914357-144914379 CCTTGCCATTAGTTCAGGGTCCC 0: 4
1: 0
2: 0
3: 4
4: 83
Right 914137484 1:144914374-144914396 GGTCCCTGGTTTGCTGCTAACGG 0: 3
1: 0
2: 0
3: 6
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914137484 Original CRISPR GGTCCCTGGTTTGCTGCTAA CGG Intronic
900423613 1:2566441-2566463 TGACCCTGGTTTGCTGCACAAGG - Intergenic
900534331 1:3169565-3169587 GGTCCCGGGGTTGTTGCTGAGGG + Intronic
902736188 1:18402764-18402786 GGTCCCTGGGTATCTGCTGACGG + Intergenic
903281836 1:22254656-22254678 GGAGCCTGGTTTGCTCCTGAAGG + Intergenic
905463579 1:38136738-38136760 GGTGGCTGGTTGGCTGCTAAGGG + Intergenic
911889511 1:103349487-103349509 GGTCTCTGGCTTGCAGATAATGG - Intergenic
912803441 1:112736594-112736616 GGTACCTGGTATGCAACTAATGG + Intergenic
913700054 1:121365652-121365674 GGTCCCTGGTTTGCTGCTAACGG - Intronic
914040603 1:144046105-144046127 GGTCCCTGGTTTGCTGCTAACGG - Intergenic
914137484 1:144914374-144914396 GGTCCCTGGTTTGCTGCTAACGG + Intronic
916983862 1:170169241-170169263 GGTCCCTGGCTTGCTTGTCACGG - Intergenic
917832134 1:178902815-178902837 AGTCACTGTTTTGCTGCTTATGG - Intronic
919777076 1:201201128-201201150 GCTACCTGGTTTACTTCTAAAGG + Intronic
924088191 1:240476182-240476204 AGTCCCTTGTTTGCTGAAAAAGG + Intergenic
1067833624 10:49624538-49624560 GTTCACTGGTTTGCTGCTTGTGG + Intronic
1069420111 10:68239446-68239468 AGACCCTGGTTTACTGCTCACGG - Intergenic
1071433553 10:85625659-85625681 GCTCCCTGGGTTGTTGCAAAAGG + Intronic
1071468541 10:85962172-85962194 GGTCCCTGGTGGGCTCCTACAGG + Intronic
1075811702 10:125228861-125228883 TTTCCCTGGCTTGCTGTTAAGGG - Intergenic
1077050937 11:566505-566527 CGTCCCTGGTCTGCTGCTGCTGG + Intergenic
1083252218 11:61475671-61475693 GATCCCTGGGATGCAGCTAAAGG - Intronic
1089760726 11:120721158-120721180 GGTCCCTGGTTGGGAGCTACGGG + Intronic
1089974409 11:122720012-122720034 GGTCCATGGTTTTCAGCTGAGGG - Intronic
1090257906 11:125298633-125298655 GGTCCCTGGTACTGTGCTAAGGG - Intronic
1090462631 11:126905690-126905712 GGTCTCTGGTGTTCTGTTAAGGG - Intronic
1090855990 11:130609695-130609717 GGTCTCTGGTTTGCAGATAAAGG - Intergenic
1093300006 12:17442534-17442556 GGTGACTTGGTTGCTGCTAAAGG + Intergenic
1095418119 12:41998035-41998057 GGTCCCTGGAATGCAGCTCAGGG - Intergenic
1096055507 12:48648057-48648079 GGTTGCTGCTTGGCTGCTAAAGG + Intergenic
1106912542 13:34478527-34478549 GTTCCCTGTCTTGCTGGTAAAGG - Intergenic
1108258494 13:48633225-48633247 GGTCCCTCTGTAGCTGCTAAGGG - Intergenic
1109098180 13:58144506-58144528 GGTGACTTGTATGCTGCTAAAGG + Intergenic
1110978450 13:81868099-81868121 GGTCTCAGGGTTGCTGCCAAAGG - Intergenic
1111723911 13:91980748-91980770 GGATCCTGGTGTGCTGGTAATGG - Intronic
1112033436 13:95476949-95476971 GGTCCCTGCTATGCTGCTCATGG - Intronic
1113987117 13:114326824-114326846 GGTTGCTGATTTTCTGCTAATGG + Exonic
1114361439 14:21977973-21977995 AGTCTTTGGTTTGCAGCTAAAGG - Intergenic
1116093692 14:40340383-40340405 GGTCTCTGTTTTGATGTTAATGG + Intergenic
1118431965 14:65727833-65727855 GGTGACTTGGTTGCTGCTAAAGG - Intronic
1119173367 14:72551340-72551362 GGTCCCTGATTGGCTGCTCGTGG + Intronic
1121333159 14:93060558-93060580 GGACCCTGCTCTGCTGCAAAAGG + Intronic
1121803408 14:96794326-96794348 GGACCCTGGTTTAATGCTTAAGG - Intergenic
1125608714 15:40956905-40956927 GAACCCTGGTGTCCTGCTAAAGG + Intergenic
1130316896 15:82803672-82803694 GGTCTCTGGTTTGGTGCTGGAGG - Intronic
1133639357 16:7701916-7701938 GCACCCTGGTTTGCTGCAACAGG - Intronic
1142396894 16:89837237-89837259 GTTCCCTGGTCTGCTGCTGCAGG + Intronic
1143175571 17:4953088-4953110 GGGCCCTGCTCTGCTGCAAAAGG + Exonic
1143867498 17:9934645-9934667 CCTCCCTGGTTTGCTGATGAGGG + Intronic
1147755228 17:42762956-42762978 GATCCCTGGATTGCTGGGAATGG + Exonic
1148339973 17:46867570-46867592 GGTCCCTGGGGTCCTGCTGACGG + Intronic
1151668374 17:75558331-75558353 GGCCCTGGGTTTGCTGCTGATGG + Intronic
1151683680 17:75634795-75634817 GGTTCCTGGTTTGGTGTTCAAGG - Intronic
1152415153 17:80155119-80155141 GGTCCCTGGCTTCCTGCAACAGG - Intergenic
1153090988 18:1342502-1342524 AGTCTCTGGTGTGCTGCTACTGG + Intergenic
1156237314 18:35217691-35217713 CGTCTCAGGGTTGCTGCTAAAGG - Intergenic
1159326636 18:66928459-66928481 ATTCCCTGGTTTGCTTCTCAGGG - Intergenic
924979298 2:206773-206795 GTTCCTTGTTTTGCTGATAATGG - Intergenic
929657001 2:43743527-43743549 AGTTCTTGGTTTGCTTCTAATGG + Intronic
931231035 2:60375091-60375113 GGTCCCTGATCTACTGATAAGGG - Intergenic
938747376 2:134292480-134292502 GTTGCCGGGTCTGCTGCTAACGG + Intronic
939178605 2:138780190-138780212 GGTCCCTGGCTTGCTGCAGCTGG - Exonic
939884871 2:147670724-147670746 GAACCCTAGTTTGCTGCTTAGGG + Intergenic
948506965 2:238434992-238435014 GGGCCCTGGTTTGGTGCTCTGGG + Intronic
1168830906 20:844873-844895 GGTCCCTGGCTACCTGCTACGGG + Exonic
1177621798 21:23604915-23604937 GGTGACTGGTGTGCTGTTAAAGG + Intergenic
1179128639 21:38614568-38614590 GGTCCCAGGGTGGCTGCTCAAGG - Intronic
1179257269 21:39727641-39727663 GGTCCCTGGTTAGCTGCAGGTGG + Intergenic
1183507710 22:38218806-38218828 GGGGCCTGGCTTGCTGCTGACGG - Intergenic
1184915298 22:47564765-47564787 GGCCCCTGGGGTGCTGCTGATGG + Intergenic
1184919573 22:47596304-47596326 GGTCACTCGTCTGCTGCCAAGGG - Intergenic
954638468 3:52084450-52084472 GGTCCCTTGTTTGCTGCCTGTGG - Intronic
965323223 3:167272364-167272386 GATCCCTGGGCTGATGCTAATGG - Intronic
966654437 3:182339079-182339101 GGTTCCTGGTTTGGAGATAAAGG + Intergenic
967321918 3:188202783-188202805 GTTTCCTTGTTTGCTGCTCATGG + Intronic
969288430 4:6222561-6222583 GGTGTCTGGTTCCCTGCTAATGG - Intergenic
971139615 4:23909885-23909907 GGTCCAATGTTAGCTGCTAAGGG + Intergenic
972215496 4:36893274-36893296 GGTCCTGGATTTGCTGCAAAGGG + Intergenic
974102760 4:57436049-57436071 GGTCTCTGGTTTCCTCTTAATGG + Intergenic
975917243 4:79340320-79340342 GGTAGCTGGTCTGCTGCTAAGGG - Intergenic
977557794 4:98502522-98502544 AGTCCTTGCTTTGCTGATAAAGG + Intronic
978177682 4:105754021-105754043 GATCCCTGTTTTTCTGCTAATGG + Intronic
978555282 4:109973145-109973167 CGTCCCTTGTTTGCTCCTGAAGG + Intronic
981578825 4:146232057-146232079 GGTCCCTTGTTTGCTTCTTGGGG - Intergenic
986187001 5:5453115-5453137 GGTTCCTTGTTTGCTGCTTTGGG + Intronic
989830702 5:45914968-45914990 GGTCCTTGGTTTCCTGAAAAAGG - Intergenic
992279629 5:75161432-75161454 GGTGACTTGTGTGCTGCTAAAGG + Intronic
993505709 5:88706449-88706471 AGCCTCTGGTTTGCTGCTAAAGG + Intergenic
996509864 5:124305720-124305742 TGTCTCAGGGTTGCTGCTAATGG - Intergenic
997437113 5:133883584-133883606 GGTGCCAGGATTGCTGGTAAAGG - Intergenic
997731013 5:136175917-136175939 GTTCTCTGGTTTACTGCTTATGG - Intronic
998921213 5:147070402-147070424 GGTTCCTGGTTTTTTGCTCAAGG - Intronic
999446125 5:151640860-151640882 AGTCACTGTTTTGCTGCCAAAGG - Intergenic
1005503988 6:26454093-26454115 GTTCCCTGGTTTTTAGCTAAGGG + Intergenic
1007832991 6:44653068-44653090 CGTCCTTGGTTTGGGGCTAATGG + Intergenic
1012247638 6:96943595-96943617 GGTCCCGGCTCTGCTACTAAGGG - Intronic
1014644848 6:123960257-123960279 GGTCTCTGGTTAAATGCTAACGG + Intronic
1019265270 7:112343-112365 AGTCCCTTGATTGCTGGTAAAGG - Intergenic
1020493322 7:8816560-8816582 TGTCCCAGGTTGGCTGCCAATGG + Intergenic
1020837406 7:13170369-13170391 GTTACCTGGTTTGGTGCTTAGGG + Intergenic
1035890469 8:3337353-3337375 TTTCCCTGGCTTGCTTCTAAGGG - Intronic
1042711929 8:71727003-71727025 GGTCCCTGGGTTTCTGAAAATGG - Intergenic
1045421803 8:102023753-102023775 GAGCCCTGGTTGGCTGATAATGG - Intronic
1048262782 8:132959736-132959758 GGTCCCTGATTTCCAGATAAAGG - Intronic
1048285895 8:133141683-133141705 GGCCCCTTGTTTGGTGCTGAAGG + Intergenic
1048368106 8:133756235-133756257 GGTGCTAGGTTTCCTGCTAAAGG - Intergenic
1050346133 9:4689823-4689845 GGCCCATGTTTTGCTGCTGAAGG + Intronic
1056030629 9:82549605-82549627 GCTCCCTCGTTTGGTGCTAGTGG - Intergenic
1061634978 9:131901930-131901952 GGTCACTGGTTTTCTGTGAAGGG + Intronic
1062136700 9:134932906-134932928 TGTCCCTGGTGTGCTGTGAATGG - Intergenic
1187721066 X:22151330-22151352 GATTCCTGGTCTGCTGCTCATGG + Intronic
1191576897 X:62715960-62715982 TGTCCCTGGTTTCCAGATAAAGG - Intergenic
1192475218 X:71435528-71435550 TGTCCCTGGCTTTCTGCTGAAGG - Intronic
1199765182 X:150936130-150936152 AGTCCCTGGTGGGCTGCCAAGGG + Intergenic