ID: 914138135

View in Genome Browser
Species Human (GRCh38)
Location 1:144919791-144919813
Sequence TCAGAAGGCAAAAGCACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914138135_914138138 -7 Left 914138135 1:144919791-144919813 CCAGAGGTGCTTTTGCCTTCTGA No data
Right 914138138 1:144919807-144919829 CTTCTGAAGATAGGTAGACTAGG 0: 3
1: 0
2: 1
3: 6
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914138135 Original CRISPR TCAGAAGGCAAAAGCACCTC TGG (reversed) Intronic
No off target data available for this crispr