ID: 914138138

View in Genome Browser
Species Human (GRCh38)
Location 1:144919807-144919829
Sequence CTTCTGAAGATAGGTAGACT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 3, 1: 0, 2: 1, 3: 6, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914138135_914138138 -7 Left 914138135 1:144919791-144919813 CCAGAGGTGCTTTTGCCTTCTGA No data
Right 914138138 1:144919807-144919829 CTTCTGAAGATAGGTAGACTAGG 0: 3
1: 0
2: 1
3: 6
4: 125
914138134_914138138 7 Left 914138134 1:144919777-144919799 CCACAACAGGGACACCAGAGGTG 0: 3
1: 0
2: 0
3: 12
4: 133
Right 914138138 1:144919807-144919829 CTTCTGAAGATAGGTAGACTAGG 0: 3
1: 0
2: 1
3: 6
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914138138 Original CRISPR CTTCTGAAGATAGGTAGACT AGG Intronic
902768584 1:18632587-18632609 CTTCTGAGGGTAGGTAGCCTAGG + Intronic
904891888 1:33785408-33785430 CTTCTGAAGCCAGGGAGACATGG + Intronic
908849532 1:68361270-68361292 CTCTTGAAGATAGGCAAACTTGG - Intergenic
910445676 1:87297041-87297063 GTTCTGAAGGCAGATAGACTTGG + Intergenic
911346615 1:96704116-96704138 CTTCTGAAGATGGGTATTATTGG + Intergenic
911390898 1:97241110-97241132 GCTATGAAGATAGGAAGACTTGG - Intronic
912519577 1:110235812-110235834 CTTTTGAAGTCAGGCAGACTTGG + Intronic
913699407 1:121360229-121360251 CTTCTGAAGATAGGTAGACTAGG - Intronic
914138138 1:144919807-144919829 CTTCTGAAGATAGGTAGACTAGG + Intronic
915927349 1:160032700-160032722 TGTCCGAGGATAGGTAGACTGGG + Intergenic
917962082 1:180153698-180153720 GTTATGAAGAAATGTAGACTGGG - Intergenic
920486817 1:206378937-206378959 CTTCTGAAGATAGGTAGACTAGG - Intronic
920969834 1:210733714-210733736 CTTCTGAGGAGAGCTAGTCTGGG + Intronic
921016309 1:211195174-211195196 CTTCTGGAGATAGGGAGTTTGGG - Intergenic
921696052 1:218212089-218212111 ATTCTTAAGGTAGGTAGATTTGG - Intergenic
922873906 1:228925052-228925074 CTGCTGAAGAGAGGATGACTTGG - Intergenic
923227305 1:231949961-231949983 CTTTTGAGGATAAGGAGACTGGG - Intronic
1063790394 10:9438813-9438835 CCTCTGAAGAAAGGTATCCTGGG + Intergenic
1064360821 10:14662746-14662768 CTTCTGATGATAGAGAAACTGGG + Intronic
1070383931 10:75906848-75906870 CCTCTGAACATAAGTGGACTTGG + Intronic
1075095268 10:119467053-119467075 TTTGTGAAGATAGTGAGACTTGG - Intergenic
1077852063 11:6082813-6082835 ATTCTGAAGACACGTAGACCTGG - Intergenic
1078197284 11:9146481-9146503 CTTCTGTAAATAGAGAGACTGGG + Intronic
1079656398 11:22991311-22991333 ATTCTGAGGATAGGTAGATAGGG + Intergenic
1086061672 11:82706353-82706375 CTTTTGAAGTCAGGTAGATTGGG - Intergenic
1087660713 11:100984791-100984813 CTTCTGAAGAGAGATACAATAGG + Intronic
1087788180 11:102379061-102379083 CTTCTGAAGCCAGGTAGATAAGG + Intergenic
1088051445 11:105520026-105520048 CTTCAGAAGATAGCCAGAATTGG - Intergenic
1090096774 11:123750036-123750058 CTTCTGGAGAAAAGTAGAATAGG + Intergenic
1090192717 11:124785938-124785960 CTTCTGAAGAGAAGTATACCAGG - Intronic
1090969714 11:131629888-131629910 ATTCTGAAGATAGGGAGTCAGGG + Intronic
1091989368 12:4942328-4942350 TTTCTAAAGATAGGTAGTTTTGG + Intergenic
1092879924 12:12880154-12880176 CTACAGAAGATAGGGAGCCTTGG + Intergenic
1097571606 12:61340070-61340092 TTTCTAAAAATAGGTAGGCTGGG - Intergenic
1098509698 12:71297284-71297306 TTTCTGAAGTTAGATAGACCTGG - Intronic
1099629619 12:85125584-85125606 CTTTTGAAAAAAGGAAGACTGGG - Intronic
1100813368 12:98362246-98362268 CTTATGAAGAATGGAAGACTTGG - Intergenic
1101612797 12:106306857-106306879 CCTCTGGAGCTAGGTGGACTGGG - Intronic
1103660842 12:122515147-122515169 CCTCTGAAGGGAGGTGGACTTGG + Exonic
1103783238 12:123413503-123413525 CTCCTGAAGCTAGGGAGACCAGG - Exonic
1103882014 12:124173386-124173408 CGTATGAAGATATGAAGACTGGG + Intronic
1105872763 13:24522166-24522188 CTTATGAAGATAAGAAGATTCGG + Intergenic
1107198566 13:37684569-37684591 CTTATGTAGATAGGAAGACAAGG + Intronic
1107693676 13:42978663-42978685 AGTCTGAAGGTAGGTAGTCTAGG - Intronic
1108503323 13:51087339-51087361 CTTCTGACCATACGTAGGCTAGG - Intergenic
1112076214 13:95916083-95916105 CTTATGCAGATAGGAAGAATGGG - Intronic
1113680495 13:112240328-112240350 CTTCTGAAGACAAGCAGGCTGGG - Intergenic
1114999178 14:28401135-28401157 CTTCTGAGGCCAGGTAGATTTGG + Intergenic
1115472562 14:33783449-33783471 CTTCTGAAGAAAGTCAGACATGG - Intronic
1116353257 14:43894468-43894490 CTTCTGATGTTAGGTAGAGTGGG - Intergenic
1118725725 14:68627732-68627754 TTTCTGAAGTAGGGTAGACTAGG - Intronic
1120385922 14:83845768-83845790 TTTCTCAAGAAAGGTTGACTTGG + Intergenic
1130122504 15:81063230-81063252 CTACTGTAGATGGGTAGTCTGGG - Intronic
1134203811 16:12221175-12221197 CTTCTGAAGAATGGCAAACTTGG + Intronic
1142546384 17:706685-706707 CTTATAAAGCTAGGTAGAGTGGG + Intronic
1144675491 17:17158927-17158949 CTTCAGAAGACAGGTGGACGGGG - Exonic
1144790362 17:17855018-17855040 CCTCTGAAGATAGGTAGGCCAGG + Intronic
1147692374 17:42324438-42324460 CTTCTAAAGTTAGATAGAGTGGG + Intronic
1148819898 17:50354305-50354327 CTTCCGAAGAAACCTAGACTTGG - Intronic
1152606545 17:81294448-81294470 CTTCTGAAGACAGGTGCAGTTGG + Intronic
1155950461 18:31905677-31905699 CTTCTGAGAAAAGTTAGACTGGG - Intronic
1159138887 18:64369179-64369201 CTTCTGAGGCCAGGTAGATTTGG + Intergenic
1160910730 19:1472671-1472693 CTTCTGGAGACAGCTGGACTGGG - Exonic
1163517665 19:17774786-17774808 CTTGTGAAGATAGGGAAAGTCGG - Intronic
1163811733 19:19436782-19436804 CTTCTCCAGGTAGGTAGCCTTGG - Intronic
1165405200 19:35626316-35626338 CTTCTTAAAATAGGTAGACCAGG + Intergenic
925614231 2:5730208-5730230 CTTCTGAATATCTGTAGAGTGGG - Intergenic
928035445 2:27818319-27818341 CTTCTGAAGATCTATAGACAAGG + Intronic
929209773 2:39342449-39342471 CTTTAAAAGATAGGTAAACTCGG - Intronic
931220281 2:60283217-60283239 CTTCTGAAGCTAGGCTGCCTGGG + Intergenic
932916650 2:75866454-75866476 CTACAGAAGAAAGGTAGACATGG + Intergenic
938121549 2:128637706-128637728 CTTCTGCAGATAGGGAGACTGGG - Intergenic
939053827 2:137338039-137338061 CTTCTAAAGATTAGTAGGCTTGG + Intronic
942233610 2:173882910-173882932 CATCTGAAGACAGTTTGACTTGG - Intergenic
942316912 2:174705491-174705513 CTCCTGAAGCTAGGTGGTCTGGG - Intergenic
946718055 2:222574202-222574224 CTTCTGGAGAGAGGTAGATCTGG - Intronic
1179072935 21:38089850-38089872 GTGCTGAAGATAAGGAGACTGGG + Intronic
1179315489 21:40240281-40240303 CTACTGAACAAAGGTAGAATGGG - Intronic
1184131263 22:42518047-42518069 CTTCTGAGGCCAGGTGGACTTGG + Exonic
1184141485 22:42580259-42580281 CTTCTGAGGCCAGGTGGACTTGG + Intergenic
950282220 3:11718653-11718675 CTTCTGAGTAGAGGTAGGCTTGG + Intronic
952510175 3:34045048-34045070 CTTATGCAGATAGGTATACAGGG - Intergenic
952973521 3:38672893-38672915 ATTTTGAAGATAGGCAGTCTAGG + Intergenic
953626859 3:44579042-44579064 CTTCAGAAGACAGGTGGACGGGG + Intronic
956058764 3:65328798-65328820 CAGCTGAAGAGAGGTAAACTGGG + Intergenic
956264202 3:67379262-67379284 CTCCTGCAGAGACGTAGACTAGG + Intronic
959160730 3:102721402-102721424 CTTCTAAGGATAGGGAGACTTGG + Intergenic
961333029 3:126154147-126154169 ATGCTGAAGATGGGGAGACTTGG - Intronic
961905209 3:130256182-130256204 CTTTTGAAGAAAGGTGGTCTTGG + Intergenic
963135707 3:141901895-141901917 CTTATAAAAATAGGCAGACTGGG - Intronic
963582751 3:147147388-147147410 CTCAGGAAGATAGGTAAACTTGG - Intergenic
967283035 3:187841022-187841044 CTTCTGTAAACAGGTAAACTTGG - Intergenic
968838568 4:2983187-2983209 ATTTGGAAGATGGGTAGACTGGG - Intronic
970201741 4:13616355-13616377 CTTCTGTAGAAATGAAGACTTGG - Intronic
970775098 4:19664129-19664151 CTTTTTAAAATAGGTAGTCTTGG + Intergenic
972893976 4:43595959-43595981 CTTCTAAAGATAGGTTTCCTGGG + Intergenic
983626836 4:169810149-169810171 CAGCTGAAAATAGGTAGATTGGG + Intergenic
984126040 4:175812224-175812246 CTACTGAAGAAAGGTAGCCATGG - Exonic
984287000 4:177743328-177743350 CATCTTAAGATTGGTAGACAAGG + Intronic
985275707 4:188235495-188235517 CTAATGAAGATAGGCAGAATTGG - Intergenic
999676624 5:154010576-154010598 CTTCTCAAGATTGGTAGAGGTGG + Intronic
1003075016 6:2975981-2976003 CTTCTCAAAATAGGTTTACTGGG + Intergenic
1003804871 6:9715833-9715855 CTTCTGAAGAAAGGTACAACAGG + Intronic
1007934866 6:45723846-45723868 CATATGAGGATAGGTAGACAAGG + Intergenic
1009382250 6:63046618-63046640 CTTATGAAGAGAGATAGTCTGGG + Intergenic
1010181043 6:73086808-73086830 CTACTGAAGATAGGTAGGAAAGG + Intronic
1012238088 6:96840959-96840981 GTTCTGAAGCTAAATAGACTAGG + Intergenic
1014378525 6:120709774-120709796 CTTTTGAAAATAGGTTAACTTGG - Intergenic
1016367832 6:143338075-143338097 CTCCTGCAGATGGGTTGACTTGG - Intronic
1017333059 6:153222195-153222217 CTTCAGAATTTAGGAAGACTTGG + Intergenic
1018208498 6:161457728-161457750 GTTCTGAAAATAGGGAGAATGGG + Intronic
1020985174 7:15124590-15124612 CTTCTAAAGATCAGAAGACTGGG - Intergenic
1021639265 7:22722210-22722232 TTTCTGAAGATGGGTACACCTGG - Intergenic
1022646815 7:32238969-32238991 TTTCAGAAGATAAGCAGACTGGG + Intronic
1027561936 7:79741323-79741345 CTTCTCACAATTGGTAGACTTGG - Intergenic
1031845433 7:126799995-126800017 TTTCAGAAGATAGTTAGAATAGG + Intronic
1033324305 7:140364613-140364635 CTCCTGTAGACAGGTAGCCTCGG - Intronic
1043111868 8:76195447-76195469 CTTGTGAAGTCAGATAGACTTGG - Intergenic
1044813213 8:96085031-96085053 ATTTTGAAGATAGGGGGACTTGG - Intergenic
1046223604 8:111247627-111247649 CTTCTGTAGAAAGATGGACTTGG + Intergenic
1046456118 8:114464183-114464205 CTTTTGAACAAAGGAAGACTGGG - Intergenic
1048918535 8:139206811-139206833 CTTCTGAAGCTGGGAGGACTGGG + Intergenic
1048993447 8:139774749-139774771 CTGATGAGGATAGGAAGACTTGG + Intronic
1051260251 9:15256882-15256904 CTTATGAACAAAGGTAGATTGGG + Intronic
1055118275 9:72628590-72628612 CTTCTAAAAATAGATTGACTTGG - Intronic
1056206445 9:84323820-84323842 CTTCTGAAGAAAGCCAGATTTGG - Intronic
1056568271 9:87793929-87793951 TTTCTGAAGATAGTTATACTAGG - Intergenic
1058971821 9:110090299-110090321 CTACTGAAGAAAGGGAAACTGGG + Intronic
1059508811 9:114824777-114824799 CTGCTAAAGAGAGGAAGACTAGG - Intergenic
1060692409 9:125675406-125675428 CTTCTGAAGATAAGAGGAATGGG + Intronic
1186131177 X:6467193-6467215 CTTATGAAAATAAATAGACTGGG + Intergenic
1189532701 X:41902679-41902701 CTTCTGAAGAAAGGTTTAATGGG - Intronic
1193235353 X:79100145-79100167 CTTCTGAAGACAGGGAGAGAAGG - Intergenic
1194250353 X:91567196-91567218 GTTTTGAAGTTAGGAAGACTTGG + Intergenic
1200569310 Y:4808441-4808463 GTTTTGAAGTTAGGAAGACTTGG + Intergenic