ID: 914139890

View in Genome Browser
Species Human (GRCh38)
Location 1:144936581-144936603
Sequence TCCTCCCCAGGTTAGATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 2, 1: 1, 2: 1, 3: 7, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914139890 Original CRISPR TCCTCCCCAGGTTAGATGTA AGG (reversed) Intronic