ID: 914139890

View in Genome Browser
Species Human (GRCh38)
Location 1:144936581-144936603
Sequence TCCTCCCCAGGTTAGATGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 2, 1: 1, 2: 1, 3: 7, 4: 91}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914139890 Original CRISPR TCCTCCCCAGGTTAGATGTA AGG (reversed) Intronic
900941320 1:5800393-5800415 GCATCCCCAGGTTAGGTGAAAGG + Intergenic
901303869 1:8218316-8218338 TCCTCCCCAGGCTACCTGTGGGG - Intergenic
902164545 1:14559687-14559709 TCCTTCCCTAGTTAGAGGTAAGG + Intergenic
903160976 1:21488981-21489003 TCCTCCCCAGGATGGCTGCAAGG - Intergenic
904849296 1:33445268-33445290 TCCTCCGCAGGCTGGATGCACGG + Intergenic
912497604 1:110101599-110101621 TCCTCCCCAGTTTAGAGTTCAGG + Intergenic
913697669 1:121343470-121343492 TCCTACCCAGGTTAGATGTAAGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
915729089 1:158040273-158040295 TCTTTCCCCAGTTAGATGTATGG - Intronic
915859026 1:159422483-159422505 CCCTCCGCAGGTGAGATGCAGGG + Intergenic
919851357 1:201675121-201675143 TCATCCCCAGGTCAGAGGTGGGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
922804781 1:228379643-228379665 TCCTGGCCAGCTTAGATTTATGG + Intergenic
923629422 1:235640134-235640156 TCCTCCCCAGGCTGAATGCATGG - Intronic
1064780780 10:18835916-18835938 TCCTTCTCAGGTTAAATCTAGGG + Intergenic
1070495876 10:77021750-77021772 TCATCCCCATGTGAGGTGTAAGG + Intronic
1072618522 10:97065104-97065126 TGCTCCCCAGGGGATATGTAAGG - Intronic
1075252186 10:120889633-120889655 TCCTCCCAAGTTTAGGTGAAGGG - Intronic
1080662629 11:34310076-34310098 TCCTCCCCCTTTTAGATGCAGGG - Intronic
1081853438 11:46289722-46289744 TCCTCTCCAGGCTAGTTGGATGG - Intronic
1083252475 11:61477358-61477380 TCCTGCCCATGTTACATGTGAGG - Intronic
1091594704 12:1869415-1869437 TCCTCACCAGGTTAGGTCTCAGG - Intronic
1094452841 12:30600801-30600823 TCCTCCCCAGGTTGGCTGCAAGG - Intergenic
1094687996 12:32738426-32738448 TCTTCCACAGGTTAGATAAAAGG - Intronic
1096817176 12:54208885-54208907 TCCCTCCCAGGCTCGATGTAAGG - Intergenic
1099605552 12:84797588-84797610 TCCTTCCCAGGATATATCTAGGG - Intergenic
1106821326 13:33467814-33467836 TCATCCCCAGGTTTGCTTTAAGG + Intergenic
1108066352 13:46581583-46581605 TCATCCCCGTGTTAGATGTGAGG + Intronic
1110443211 13:75548493-75548515 TCTTCCCCAGGTCAAATTTATGG + Intronic
1112973462 13:105288180-105288202 TCTTCTCCAGGGTAGATGTTAGG - Intergenic
1115323662 14:32113383-32113405 CCCTCCCCTTGTTATATGTATGG + Intronic
1118514220 14:66508584-66508606 TCCTCCCCCGGTTACCTGTAAGG - Exonic
1119769591 14:77212099-77212121 TCCTCCTCAGCTTATTTGTAAGG - Intronic
1119866649 14:77980319-77980341 TCCTCCCCAGGTTGGACTGATGG - Intergenic
1121003466 14:90470011-90470033 TCCTCCCCAGGTTACAAGTTTGG - Intergenic
1123816950 15:23990073-23990095 TGCTCCCCAGGTAACATGGAAGG + Intergenic
1125736904 15:41933290-41933312 TCCTCCCCAGGATACACGTGTGG - Intronic
1126165900 15:45653585-45653607 CCCTCCCAAGGTTAGAGGTGGGG + Intronic
1126729091 15:51663494-51663516 TTCTCCCCATGTTGGATGTTGGG - Intergenic
1126817233 15:52466064-52466086 TGCTCCGCATGTTAGATCTAGGG - Intronic
1137982975 16:53085421-53085443 TCCTCCCCAAGGCAGATGTCAGG - Intronic
1139269697 16:65670682-65670704 ACCCCCCCAGTTTAGATGTGAGG - Intergenic
1139430432 16:66908262-66908284 TCCACCCCAGGGCAGATGGAGGG + Exonic
1142709548 17:1715803-1715825 CCCTCCCCAGGCTAGATGGCCGG + Intergenic
1144146543 17:12404572-12404594 ACCTCCCCAGGTTACAGGTGAGG - Intergenic
1148619435 17:49023132-49023154 TCCTCACAAGGGTAGATGTGGGG + Intronic
1156867215 18:41902431-41902453 TCTTCCCTAGGTTTTATGTATGG - Intergenic
1157971855 18:52279517-52279539 TCCTCACCATGTCAAATGTAAGG - Intergenic
1158220554 18:55146274-55146296 TCCTCCCCAGGTTGGTGGGAAGG + Intergenic
1161990336 19:7681033-7681055 TTCTCCCCAGTGTAGAGGTACGG + Intronic
1162561689 19:11421189-11421211 TCCTCGCCAGCTTAGAGGGAAGG - Exonic
1168147141 19:54426158-54426180 TGCTCCCCACGTTACATGTAGGG + Intronic
926966834 2:18424280-18424302 TTCTTCCCAAGTTAGTTGTAAGG + Intergenic
940371295 2:152903953-152903975 TACTCCTCAGGTTAAAGGTAAGG + Intergenic
941425435 2:165338929-165338951 TCCACGCCCGGCTAGATGTAGGG - Intronic
1169641432 20:7756808-7756830 TCCTCCCCAGAATAGATCTTAGG - Intergenic
1173475397 20:43355658-43355680 TGCTCCCCAGGTCAGCTGTGAGG - Intergenic
1173497068 20:43527435-43527457 TCCACCTCAGGTTAGATTGAAGG + Intronic
1173834028 20:46113451-46113473 TCCTCCCCAAGATTGCTGTATGG - Intergenic
1181844628 22:25697221-25697243 TCCTCCCCAGCCTATATGCATGG - Intronic
950333490 3:12175741-12175763 TCCATCCCAGGCTAGAGGTAAGG - Intronic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
958805017 3:98799718-98799740 TCCTGCCCTGGTGAGTTGTAAGG + Exonic
965499252 3:169438052-169438074 TCATCCCCATTTTATATGTAAGG + Intronic
967960109 3:194913624-194913646 TCCTCCCCAAGTCACATGAAAGG + Intergenic
971717015 4:30191037-30191059 TCCTCAAAAGGTTAAATGTAGGG + Intergenic
971820044 4:31539933-31539955 TCCTTCCCATGTTAGATCCAAGG + Intergenic
972437325 4:39045862-39045884 TCTTCCAGAGGTTAGATGTGCGG + Intronic
972726119 4:41747389-41747411 TCCTCCCGAGTGTAGATGTCGGG + Exonic
976280486 4:83322082-83322104 TCCTCCACAGGTCAGATGAGGGG + Intronic
977020635 4:91754881-91754903 TCTTCCAGAGGTTTGATGTAGGG - Intergenic
977045865 4:92068838-92068860 TCCACCCCTAGTCAGATGTATGG - Intergenic
978371675 4:108035768-108035790 TCCTACCCAGGTTCTATGTGCGG - Intergenic
978806163 4:112802830-112802852 TCCTCCCGAGGTGATATGTTAGG + Intergenic
978854467 4:113378261-113378283 TCCTCTTTAGGGTAGATGTAGGG - Intronic
979613907 4:122719779-122719801 TCAAGCCCAGGTTAGATGAAGGG + Intergenic
983181660 4:164655936-164655958 TCCTTCCCAGGATGTATGTAGGG - Intergenic
983564786 4:169138307-169138329 TCCTGCACAGGTTGGGTGTAAGG + Intronic
989702666 5:44289025-44289047 TCTTCCCCAGGATATCTGTATGG - Intergenic
995647845 5:114332890-114332912 TCCTTCCCAGGTTATATTTTGGG - Intergenic
998894380 5:146783233-146783255 TCATCCCCAGGTTTAATTTATGG + Intronic
999592707 5:153166437-153166459 TCCTCTCCAGAATAGATGTTGGG - Intergenic
1000036760 5:157454602-157454624 TCTTATCCAGGTTGGATGTAAGG + Intronic
1000040535 5:157481535-157481557 CCCTCCCCAGGTCAGGTGCAGGG + Intronic
1002300537 5:178255158-178255180 CCCTCCCCAGGGTGGATGGAGGG + Intronic
1003459490 6:6317262-6317284 TCATCCCCATGTTATATGTTAGG - Intronic
1004880373 6:20001679-20001701 TCCTCCCCATGTTATAGGTAAGG + Intergenic
1004942972 6:20580638-20580660 CCCTCTCCAGGTTATAAGTAAGG + Intronic
1007251427 6:40497759-40497781 TCTTCCCCAGGATTGATGCATGG + Intronic
1009773172 6:68171037-68171059 TTCTGCCCAGGTTAGAGATAGGG + Intergenic
1011354731 6:86462315-86462337 CCCTCCCCAGGTGAGAGGCAGGG - Intergenic
1016175746 6:141075796-141075818 TTCTCCCCAGGTTAGCTCTAGGG + Intergenic
1022414838 7:30168975-30168997 TCTTCCACAGTTTAGAGGTATGG - Intergenic
1022621247 7:31986721-31986743 TCTTCCCCAGGGTCGATGGAAGG + Intronic
1025744325 7:64229699-64229721 TACTCCCCTGGCTAGATTTAGGG - Intronic
1034885452 7:154795042-154795064 TCCGCCCCAGGTTAGATAAAAGG - Intronic
1035860010 8:3018361-3018383 TCCACCCCAGGTAGGATTTAAGG + Intronic
1046473688 8:114712756-114712778 TAATCCCCAGGTTAGAAGTTAGG - Intergenic
1048516258 8:135114220-135114242 TCATCTCCAGGTGAGATGTTGGG + Intergenic
1050366993 9:4881915-4881937 TCTTCCCCAGGATTGATCTAGGG - Intronic
1053822154 9:41979019-41979041 TCATCCCCAGGTGGGATGTGGGG + Intronic
1199338399 X:146646368-146646390 TCCTACCCACGTTAAATGTGTGG + Intergenic