ID: 914144264

View in Genome Browser
Species Human (GRCh38)
Location 1:144979951-144979973
Sequence ATTTGTATGCACATGTATCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914144261_914144264 27 Left 914144261 1:144979901-144979923 CCTCAGGTATTTATTTACAGCAT 0: 3
1: 8
2: 76
3: 613
4: 1692
Right 914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG No data
914144263_914144264 -8 Left 914144263 1:144979936-144979958 CCTAATACACTGTGTATTTGTAT 0: 3
1: 0
2: 2
3: 32
4: 374
Right 914144264 1:144979951-144979973 ATTTGTATGCACATGTATCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914144264 Original CRISPR ATTTGTATGCACATGTATCT AGG Intronic
No off target data available for this crispr