ID: 914150609

View in Genome Browser
Species Human (GRCh38)
Location 1:145038802-145038824
Sequence CATTGTAAAGGGAGTAGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 326
Summary {0: 4, 1: 0, 2: 2, 3: 25, 4: 295}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914150609_914150615 -6 Left 914150609 1:145038802-145038824 CCTTCCCTACTCCCTTTACAATG 0: 4
1: 0
2: 2
3: 25
4: 295
Right 914150615 1:145038819-145038841 ACAATGTTGATTTCATCCTTGGG 0: 3
1: 0
2: 3
3: 29
4: 291
914150609_914150617 19 Left 914150609 1:145038802-145038824 CCTTCCCTACTCCCTTTACAATG 0: 4
1: 0
2: 2
3: 25
4: 295
Right 914150617 1:145038844-145038866 TTCATAATGAACTTCTGTAAAGG 0: 4
1: 0
2: 1
3: 20
4: 195
914150609_914150614 -7 Left 914150609 1:145038802-145038824 CCTTCCCTACTCCCTTTACAATG 0: 4
1: 0
2: 2
3: 25
4: 295
Right 914150614 1:145038818-145038840 TACAATGTTGATTTCATCCTTGG No data
914150609_914150619 21 Left 914150609 1:145038802-145038824 CCTTCCCTACTCCCTTTACAATG 0: 4
1: 0
2: 2
3: 25
4: 295
Right 914150619 1:145038846-145038868 CATAATGAACTTCTGTAAAGGGG 0: 4
1: 0
2: 0
3: 12
4: 191
914150609_914150618 20 Left 914150609 1:145038802-145038824 CCTTCCCTACTCCCTTTACAATG 0: 4
1: 0
2: 2
3: 25
4: 295
Right 914150618 1:145038845-145038867 TCATAATGAACTTCTGTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914150609 Original CRISPR CATTGTAAAGGGAGTAGGGA AGG (reversed) Intronic
902655201 1:17862343-17862365 CATTGAACATGGAGTTGGGAAGG + Intergenic
903336097 1:22625793-22625815 CAAGGTAAAGGGAGGAGGGGAGG + Intergenic
904174307 1:28615360-28615382 TATTTTAATGGGATTAGGGAGGG - Intronic
904362589 1:29986498-29986520 TATTATAATGGTAGTAGGGAAGG - Intergenic
906585259 1:46970470-46970492 TATGGTAATGGGAGTAGGGAAGG - Intergenic
907932341 1:59012229-59012251 CCTTGTAAAGTGAGTATAGAGGG - Intergenic
909830363 1:80181623-80181645 TATTGTAGAGGGAGAAGAGAAGG + Intergenic
913070740 1:115296198-115296220 CATTGCAAGAGGAGTAGGGGAGG + Intronic
913526974 1:119702939-119702961 CAAGATAAAGGGAGCAGGGAGGG - Intronic
913686985 1:121241487-121241509 CATTGTAAAGGGAGTAGGGAAGG + Intronic
914038844 1:144029127-144029149 CATTGTAAAGGGAGTAGGGAAGG + Intergenic
914150609 1:145038802-145038824 CATTGTAAAGGGAGTAGGGAAGG - Intronic
915281394 1:154824744-154824766 CATTTTAAAGGAAGCAGTGAAGG + Intronic
915604564 1:156942413-156942435 AATGGTGAAGGGAGTAGGGCAGG + Intronic
916326796 1:163570273-163570295 CATTGTAGGGGCAGCAGGGAAGG - Intergenic
917332059 1:173891325-173891347 CATTGCAAAGGGAAAAGGTAGGG - Exonic
918599997 1:186346865-186346887 ATTTGTAAAGTGAGTAGTGAGGG - Intronic
919014949 1:192020474-192020496 CATATTAAAGGGAGTATAGATGG - Intergenic
919838644 1:201593679-201593701 CATTGTCATGGGGGAAGGGAAGG + Intergenic
920106173 1:203555287-203555309 CATTATAAAGGAAGAAGGAATGG + Intergenic
920264915 1:204714662-204714684 CATTGGGAAGGGAGTTGGGGAGG + Intergenic
920474314 1:206260006-206260028 CATTGTAAAGGGAGTAGGGAAGG + Intronic
920628565 1:207628275-207628297 CATAGTCCAGGGAGCAGGGATGG - Intronic
921197162 1:212769152-212769174 TGTTGTAGAGGGAGAAGGGATGG + Intronic
922086212 1:222349497-222349519 CATTCTGAAGGGATAAGGGATGG + Intergenic
922842651 1:228656120-228656142 CATTGCAAAGTGAATATGGAAGG - Intergenic
923649322 1:235858789-235858811 CATTGTTATGGGGGTGGGGAAGG + Intronic
1063737616 10:8778345-8778367 AATTATAAAGGAAGTAGGGGTGG + Intergenic
1066084165 10:31960618-31960640 TATTTAAAAGGGAGTCGGGAGGG - Intergenic
1066681565 10:37940404-37940426 CCTTGAACAGGGAGTAGGAAAGG + Intergenic
1067409966 10:46055554-46055576 CATTGTCAAGGGAGGAGGAAGGG - Intergenic
1067971286 10:50973693-50973715 TAATGTAAAGGGAAAAGGGAGGG - Intergenic
1069862029 10:71477512-71477534 GATTGTAGAGGGAGCAGGGAAGG - Intronic
1069903625 10:71719849-71719871 GATAGCTAAGGGAGTAGGGATGG + Intronic
1070592880 10:77812870-77812892 CTTTGTAAAGGGAGAAGGCTGGG + Intronic
1070675015 10:78406383-78406405 CAGAGTAAAGGGAGCCGGGAGGG - Intergenic
1071037956 10:81270007-81270029 GATTTTAAGGGGAGTAGAGAGGG + Intergenic
1071160017 10:82734663-82734685 CATTTAAAAGGCTGTAGGGAAGG - Intronic
1071407459 10:85351804-85351826 CATTGTAAGAGGAATAGGTAGGG + Intergenic
1072528643 10:96297509-96297531 CATTGTAAAAGGAGAGAGGATGG - Intergenic
1072674617 10:97456504-97456526 CATGGGAAAGGGAGGAGGGAAGG - Intronic
1075221260 10:120586804-120586826 AATTGCACAGGGAGTGGGGAGGG + Intronic
1075710604 10:124528657-124528679 GATTTTAAAGGCAGTGGGGAAGG - Intronic
1076947194 10:133659456-133659478 CTCTGCAAAGGGACTAGGGAGGG + Intergenic
1077249740 11:1555668-1555690 CATGGGCAAGGGAGAAGGGAGGG + Exonic
1077766503 11:5164499-5164521 CATTGGGAAGAGACTAGGGAGGG + Intronic
1078179583 11:8999887-8999909 CAGGGTAAGGGGAATAGGGAAGG - Intronic
1078982692 11:16554613-16554635 AATTGTTAAGAGAGTAAGGAAGG - Intronic
1080904966 11:36534664-36534686 CATTGCAAAAGATGTAGGGAAGG + Intronic
1082264656 11:50105989-50106011 AACTGTAAAGGCAGCAGGGAAGG - Intergenic
1082946223 11:58763662-58763684 GATTTTAAAGGGGCTAGGGATGG + Intergenic
1085610434 11:77943381-77943403 CAGTGGAAATGGAGAAGGGATGG + Intronic
1088538915 11:110892624-110892646 GATTGAGAAGGGAGGAGGGAAGG + Intergenic
1088584960 11:111353969-111353991 GGTTGGAAAGGGAGAAGGGAAGG + Exonic
1089009994 11:115124406-115124428 AATGGCAAAGGGAGGAGGGAAGG - Intergenic
1089625279 11:119747217-119747239 CTTTGAAAATGGAGTGGGGAGGG - Intergenic
1089707518 11:120290504-120290526 CATGGTACAGGCAGAAGGGAGGG + Intronic
1090108184 11:123874446-123874468 AATTTTAAAGAGAGTAGTGAGGG - Intergenic
1091637269 12:2206593-2206615 CATTGGACAGTGAGTAGGTAGGG - Intronic
1092048260 12:5448603-5448625 CATTGTTTTGGGAGTAGGGCTGG + Intronic
1092061907 12:5557939-5557961 CATTGTAGGGTGAGTAGGGCAGG + Intronic
1092505089 12:9090494-9090516 CATAAGAAAGGGAGTAGAGAGGG + Intronic
1093955420 12:25212224-25212246 CATTGTAAAAGTAGTAGAAATGG - Intronic
1094219017 12:27973874-27973896 CATTGCCCAGGAAGTAGGGAAGG - Intergenic
1094486578 12:30930173-30930195 CAGGGTAGAGGGAGTTGGGAAGG + Intronic
1095466500 12:42492802-42492824 GATTATAGAGGGACTAGGGAAGG + Intronic
1095732018 12:45516419-45516441 CATTATAAAGGGAGTGGGGTGGG - Intergenic
1097541247 12:60946311-60946333 CTTTGGAGAGGGAGAAGGGATGG + Intergenic
1099924153 12:88997009-88997031 CATTGGAAAGGGAAAAGAGAGGG + Intergenic
1100273276 12:93046639-93046661 CATTGTAAAGGCATTTTGGAGGG - Intergenic
1100580929 12:95939846-95939868 CATTGCAAGGGTAGTAGGAATGG + Intronic
1100632985 12:96406705-96406727 CCTTTTAATGGGAGAAGGGAGGG + Intergenic
1100716818 12:97314487-97314509 TGTTGTAAAGTCAGTAGGGATGG - Intergenic
1100915561 12:99416928-99416950 CAGTGCAAAGGGAGAAGGGCAGG + Intronic
1100957617 12:99926461-99926483 CATTTTAAAGGCAGTTGGGCTGG - Intronic
1101614614 12:106324367-106324389 CATTGTGACGGGAGTAGAGTTGG + Intronic
1101700315 12:107167753-107167775 CATTGAAAAGGTATGAGGGAGGG - Intergenic
1102012333 12:109626403-109626425 GATGGTAGAGGGATTAGGGAGGG - Intergenic
1102449630 12:113031212-113031234 CACTGTAATGTGATTAGGGAAGG + Intergenic
1103319232 12:120081009-120081031 CATTGCAAAGTGAGTAGGGATGG + Exonic
1103583899 12:121936869-121936891 AATTGGAAGGGGAGAAGGGAAGG + Intronic
1104471448 12:129033051-129033073 CATTGTAAGGGGCGGAGTGAGGG - Intergenic
1108589625 13:51901658-51901680 CTTTGTAAAGGGACTTGGGATGG - Intergenic
1110449794 13:75628806-75628828 TGTTGTAAAGGAAGAAGGGATGG - Intronic
1112812798 13:103237936-103237958 CATTGTGATAGAAGTAGGGAAGG + Intergenic
1114870393 14:26648729-26648751 CAAAGGAAAGGGAGAAGGGAAGG - Intergenic
1117534093 14:56687726-56687748 CATTGCAGATGGAGTAGGGGAGG + Intronic
1118549926 14:66939425-66939447 CATTGTAGGGTGAGTAGGGCAGG + Intronic
1118891876 14:69916771-69916793 GAATGTAAAGGGTGTAAGGAGGG - Intronic
1118963742 14:70560421-70560443 AAATGTAATGGGGGTAGGGAGGG + Intergenic
1119736173 14:76984006-76984028 CACTGAAGAGGGAGTTGGGAAGG + Intergenic
1120109283 14:80534527-80534549 CACTGTTAAGGGAGCAGGGCCGG + Intronic
1121752055 14:96365207-96365229 CAATGTAAAGGGAGTGGAGATGG + Exonic
1122500110 14:102191739-102191761 CACTGGAAAGGGATTGGGGAGGG + Intronic
1122852895 14:104546462-104546484 CATTGTAAAGGGCGTCTGGCAGG - Intronic
1123065971 14:105619374-105619396 CCTTGTAAAGGGAGGTGGTAGGG - Intergenic
1123070133 14:105638620-105638642 CCTTGTAAAGGGAGGTGGTAGGG - Intergenic
1123074723 14:105662282-105662304 CCTTGTAAAGGGAGGTGGTAGGG - Intergenic
1123089370 14:105735407-105735429 CCTTGTAAAGGGAGGTGGTAGGG - Intergenic
1123095159 14:105763564-105763586 CCTTGTAAAGGGAGGTGGTAGGG - Intergenic
1123121965 14:105920910-105920932 CCTTGTAAAGGGAGGTGGTAGGG + Intronic
1126385273 15:48087776-48087798 CATTGATAAGGGTCTAGGGAAGG + Intergenic
1128585307 15:68844161-68844183 CATTTGGAAGGGAGAAGGGAAGG - Intronic
1129259315 15:74355412-74355434 CATTGGAAATAGACTAGGGAGGG - Intronic
1129414929 15:75370563-75370585 CCTTATAAATGGAGTTGGGAGGG - Exonic
1130609172 15:85345016-85345038 CTTTCTAAAAGGAGTAGGGCGGG - Intergenic
1132180028 15:99745274-99745296 CATTGCCAAGGGAGAGGGGAAGG - Intergenic
1134871416 16:17655481-17655503 CACTGCAAAGGGACCAGGGATGG - Intergenic
1136870747 16:33805266-33805288 CATTGTAATGGGAATATGCATGG - Intergenic
1139607235 16:68028044-68028066 AATTTTACAGGCAGTAGGGAAGG + Intronic
1203101425 16_KI270728v1_random:1310792-1310814 CATTGTAATGGGAATATGCATGG + Intergenic
1143744741 17:8984013-8984035 CATTGTAAAGGAAGAAGAAAAGG + Intergenic
1144442965 17:15300590-15300612 CATTTTTATGGAAGTAGGGAAGG + Intergenic
1146948385 17:36889533-36889555 CATTGAAAAGACAGTGGGGATGG - Intergenic
1147799856 17:43077031-43077053 CAATGTGGAGGCAGTAGGGATGG - Intronic
1148527705 17:48357149-48357171 CATTGTATAGGGAATACAGAAGG + Intronic
1148689901 17:49521104-49521126 AAGTGAAAAGGGAGTAGGGCTGG + Intergenic
1148799524 17:50214568-50214590 CAGTGTAAAGGGTGCCGGGATGG - Intergenic
1148980666 17:51571673-51571695 CATTGCAAAGGGAGAAGACAAGG - Intergenic
1150287059 17:63960524-63960546 AATTGCAAAGGGAATTGGGAAGG + Intronic
1150797854 17:68253552-68253574 CTTTGAAAAGGGGGTAGGGTTGG + Intronic
1151252281 17:72845496-72845518 CATTTTAAATAGAGTAGGTAGGG - Intronic
1152007564 17:77691995-77692017 CACTGTGACGGGGGTAGGGACGG - Intergenic
1153872132 18:9331173-9331195 CATTGTAAAGAGGGGTGGGAAGG + Intergenic
1155595497 18:27481372-27481394 TACTGTGAAAGGAGTAGGGAGGG - Intergenic
1156442775 18:37208183-37208205 CAATGTAGGGGGAGGAGGGAAGG - Intronic
1156934541 18:42687583-42687605 AATTTTAAAAGGAGTAGAGAAGG - Intergenic
1158110542 18:53935873-53935895 CATTAGAAAAGGAGTAGAGAAGG - Intergenic
1158415898 18:57249517-57249539 CATTGTAAAGGGAGCCAGCACGG + Intergenic
1159606601 18:70480800-70480822 TTTTGTAAATGGTGTAGGGAAGG + Intergenic
1160008992 18:75089517-75089539 CATAGTGAAGGAAGCAGGGATGG - Intergenic
1163812167 19:19440172-19440194 CAATGTAAAGGAAGAAGAGATGG + Intronic
1164774195 19:30838973-30838995 CATTGTAAAATAAGTTGGGAAGG - Intergenic
1164868152 19:31622148-31622170 CATTGGAAAGAGAGAGGGGATGG + Intergenic
1165981212 19:39725965-39725987 CAAAGTAAAGGGAGAAGAGAAGG - Intergenic
1166124138 19:40703621-40703643 TACTGTAAAGGGAGAAGGGAGGG + Exonic
1166661131 19:44647845-44647867 TATTGGAAAGGGAGCTGGGAGGG + Intronic
1167346837 19:48951282-48951304 CTCTGTAACTGGAGTAGGGAAGG + Intergenic
1167763853 19:51466790-51466812 CATAGTAAATGGAGTAGTGTAGG + Intergenic
1168258755 19:55181188-55181210 TATTGGATTGGGAGTAGGGATGG - Intergenic
1168334570 19:55590470-55590492 CATTCTGAAGGCAATAGGGAAGG - Intergenic
930365575 2:50435281-50435303 CATTATAAATGAAGCAGGGAGGG - Intronic
931675020 2:64686102-64686124 CATTGGAAAGGGAGGGGGGATGG - Intronic
931756816 2:65382025-65382047 CACTCCAAAGGGAGAAGGGAGGG + Intronic
932055397 2:68438158-68438180 CATTGTGAAGGGAATAAGAAGGG + Intergenic
933570702 2:84007341-84007363 CATTATAAAGGCATTAGTGAGGG + Intergenic
937265664 2:120613350-120613372 CTTTGAAGAGGGAGCAGGGAAGG - Intergenic
942417573 2:175775166-175775188 CTTTGTAGAGGGTGTAGGGTGGG - Intergenic
942454419 2:176128549-176128571 CATTGAAACGGGAGCAGAGAGGG + Intergenic
944718195 2:202396382-202396404 TATTGTAAGGGGAGTATAGATGG + Intronic
945221727 2:207490457-207490479 CATTGTGAAGGGAGTGGAGAGGG + Intergenic
945371582 2:209025132-209025154 TTTTGTAAAGGGTGTAAGGAAGG - Intergenic
945468655 2:210201269-210201291 CATTGTAGATTGAGTAGGGCAGG - Intronic
946444881 2:219729750-219729772 CTTTGCATAGGGAGCAGGGAGGG + Intergenic
1171990942 20:31695888-31695910 CAGAGAAAAGGGATTAGGGATGG - Intronic
1172244048 20:33433620-33433642 CACTGGAATGGGAGGAGGGAAGG + Intronic
1173409116 20:42794023-42794045 CACTGTAGAGAGAGTTGGGAAGG + Intronic
1173738618 20:45379914-45379936 CAGGGTAAAGGGAACAGGGAGGG + Intronic
1173756549 20:45521740-45521762 CATGGGAAAGGGGGTGGGGAGGG - Intergenic
1174027133 20:47586730-47586752 CAGAGTAAAGGGGTTAGGGAAGG - Intronic
1175362223 20:58421670-58421692 TATTTTAAAGAGAGGAGGGAGGG + Intronic
1176907523 21:14520907-14520929 CATTGTAGGGTGAGTAGGGCAGG - Intronic
1177838553 21:26212242-26212264 CATTGTAGGGTGAGTAGGGCAGG + Intergenic
1178503762 21:33146773-33146795 CATTGGTAGGGGAGTGGGGAAGG - Intergenic
1178603981 21:34019127-34019149 CAGTGAGAAGGGAGCAGGGAGGG - Intergenic
1182932375 22:34187435-34187457 AAATGTAAAGGGGGAAGGGAAGG - Intergenic
1184535540 22:45084319-45084341 CATTGCAAAGGGTGCAGGGAAGG - Intergenic
949590331 3:5487560-5487582 CAATGTGCAGAGAGTAGGGAAGG + Intergenic
949943777 3:9174460-9174482 CAAGGTGGAGGGAGTAGGGAAGG + Intronic
950182247 3:10922789-10922811 CATGCTAAAGGGAATGGGGAAGG + Intronic
950884971 3:16355292-16355314 CATTGTTATAGGAGTAGGAATGG - Intronic
951035675 3:17929212-17929234 CATTGGCATGGGGGTAGGGATGG + Intronic
953286415 3:41614660-41614682 CATTGCATGGGGAGTAGAGATGG - Intronic
953935720 3:47040287-47040309 CATTTTAATGCGAGTAAGGAAGG + Intronic
954336666 3:49922473-49922495 CTCTGTAAAGGGAGGAAGGAAGG + Intronic
954676696 3:52319799-52319821 CATTGTGAAGGGCTGAGGGATGG + Intronic
954753883 3:52828554-52828576 CATTGGAAACTGAGTTGGGAAGG + Intronic
956203922 3:66736671-66736693 CATAGCAGAGGCAGTAGGGAGGG - Intergenic
956240251 3:67122260-67122282 AATTATAAAGGGACTAGGAAAGG - Intergenic
957080262 3:75630960-75630982 CTCTGCAAAGGGACTAGGGAGGG - Intergenic
958265395 3:91432189-91432211 CATGGTCAAGAGAGCAGGGATGG - Intergenic
959676179 3:109038608-109038630 TTTTGTAAAGGGTGTAAGGAAGG + Intronic
959776767 3:110174109-110174131 CTATGAAATGGGAGTAGGGAAGG - Intergenic
961127957 3:124438178-124438200 CATTTTGAAGGGAGTTTGGAGGG - Intronic
961412144 3:126730267-126730289 AATTGTCAGGAGAGTAGGGATGG + Intronic
962164104 3:133031106-133031128 TATTGTAAAGAGAGCAGGGTAGG + Intergenic
963466687 3:145690474-145690496 CTTTGTGAAAGAAGTAGGGATGG + Intergenic
964529236 3:157649134-157649156 TATTCTAAAGGAAGTAGGGATGG - Intronic
964749623 3:160042323-160042345 CAGTGGAATGGGAGTGGGGAGGG + Intergenic
964905283 3:161712018-161712040 TATTGTAAAAGGTGTAAGGAAGG - Intergenic
965449978 3:168825754-168825776 CATTGTCAATGGAGTAGAGAAGG - Intergenic
966999732 3:185322489-185322511 CATGGAAAACAGAGTAGGGATGG - Intronic
967003157 3:185356385-185356407 TTTTTTAAAGGGAGTAAGGAGGG + Intronic
967898759 3:194425062-194425084 CATTGTGGAGGGAGTTAGGATGG - Intronic
968536087 4:1130601-1130623 CATTTTAATGGGAGGAGGGGGGG - Intergenic
969228839 4:5815971-5815993 GATTGGAAAGGAAGGAGGGAGGG + Intronic
971499472 4:27302643-27302665 CATTCTAAAAGGAGAAGGGTAGG + Intergenic
973238680 4:47933302-47933324 ATTTGTAAAATGAGTAGGGATGG + Intronic
974571339 4:63653183-63653205 CATTGTAAAGAGAGTAGATGAGG + Intergenic
975713925 4:77187685-77187707 CATGGTAAAAGGAGCAGGGGAGG - Intronic
975934340 4:79560415-79560437 CACAATAAAGGGAGTAGGCAGGG + Intergenic
976145367 4:82037683-82037705 CATTTTAAGGAGAGAAGGGATGG + Intronic
976724810 4:88205582-88205604 CATTGTAAAGGAAGAACTGATGG - Intronic
977694406 4:99950287-99950309 CAGTATAAAGGGAGCAGGGAAGG - Exonic
977764993 4:100786797-100786819 CATTGCTGAGGGGGTAGGGAGGG + Intronic
978783875 4:112586990-112587012 AATTGTAATGGTAGTAGTGATGG + Intronic
979464287 4:121018461-121018483 AATTGTAAAGGGAGGACAGAGGG + Intergenic
979611097 4:122689727-122689749 CATTGTAAAGGTCCTGGGGAGGG - Intergenic
981520535 4:145657125-145657147 CATTGTAAAGAAGGTAGGAAAGG + Exonic
982378009 4:154715922-154715944 AATAGTAAAGGGAAGAGGGAGGG - Intronic
982919512 4:161255510-161255532 CATTTTAAAGGGCCTATGGAAGG - Intergenic
983197338 4:164822096-164822118 CATTGTAATGAGAATAGGGATGG + Intergenic
983644494 4:169976226-169976248 CATTCTAGAGGCAGTAGTGAGGG - Intergenic
983843322 4:172483346-172483368 CATTGTGAAGGGAGTGCAGAGGG + Intronic
984365254 4:178791454-178791476 CATTGTTAAGGGAATAAGGGAGG + Intergenic
984787374 4:183580802-183580824 CATTGTGTAGGGGGTTGGGAGGG - Intergenic
985450654 4:190060255-190060277 CTCTGCAAAGGGACTAGGGAGGG + Intergenic
988499987 5:31776419-31776441 CAATGTATGGGGAGTAGGGTAGG - Intronic
989469206 5:41795404-41795426 GATTGTGAAGGGAATGGGGATGG - Intronic
990528532 5:56651972-56651994 CAGAGAAAAGGGAGTAGAGAAGG + Intergenic
991238860 5:64432716-64432738 CATTGGAAAGGTAGCAGGGAAGG + Intergenic
994626435 5:102226012-102226034 TGTTGTCAAGGGAGTGGGGAAGG - Intergenic
994979611 5:106856843-106856865 CATTGTAGGGTGAGTAGGGCAGG + Intergenic
996274806 5:121651863-121651885 ATTTCTAAAGGGGGTAGGGATGG + Intergenic
997138192 5:131348960-131348982 TTTTGTATAGGGTGTAGGGAAGG - Intronic
1000657915 5:163904193-163904215 CATTGTAAATGGAGTAAGGATGG + Intergenic
1002770176 6:283614-283636 CCATATAAAGGGAGAAGGGAAGG + Intergenic
1003527634 6:6911238-6911260 CAATGATAAGGGAATAGGGAAGG + Intergenic
1005403302 6:25458014-25458036 CAGGGGAAAGGGAGTAAGGAGGG + Intronic
1005702395 6:28415050-28415072 AACTGTAAAGGGAGTGGGGTGGG - Intergenic
1006785958 6:36667446-36667468 CACTGAACAGGGAGGAGGGAAGG - Intergenic
1007298276 6:40845497-40845519 TAATGTATAGGGAGTAGGGAGGG + Intergenic
1008558832 6:52703460-52703482 ATTTGTAAAGGGAGGAGGGAAGG - Intergenic
1008680124 6:53863248-53863270 CTATGTAAAGGGAGGAGGGCAGG - Intronic
1008696987 6:54050018-54050040 CATTGCAAAGTGGGTAGAGAGGG + Intronic
1011538114 6:88400286-88400308 CATTGTAAATTCACTAGGGAGGG - Intergenic
1014547763 6:122752800-122752822 CAATGTAGAGGGGGTAGAGATGG - Intergenic
1014824392 6:126032117-126032139 CATGGTCCTGGGAGTAGGGATGG - Intronic
1015174986 6:130296660-130296682 CTCTGTATAGGGACTAGGGATGG - Intronic
1015856119 6:137626253-137626275 CATTGGAAAGCGAGTCTGGATGG + Intergenic
1016670372 6:146698563-146698585 CATTGAAAAGTGGGTAGGGAGGG + Intronic
1016841656 6:148531968-148531990 CAAAATAAAGGGAGTGGGGAAGG + Intronic
1018553950 6:165031289-165031311 CATTGTAATGTGAGTTGGAAAGG + Intergenic
1018843570 6:167537463-167537485 CAAAGGAAAGGGAGAAGGGAAGG + Intergenic
1019486723 7:1292821-1292843 CTTTGTCCTGGGAGTAGGGATGG + Intergenic
1019828837 7:3305579-3305601 AGTTGTAAAGGGAGTAGGTTAGG - Intronic
1019914455 7:4123854-4123876 CATGGTAGGGGGAGAAGGGAAGG + Intronic
1020042562 7:5015260-5015282 CATTCTTGAGGGATTAGGGATGG + Intronic
1020289295 7:6710517-6710539 CATTCTTGAGGGATTAGGGATGG + Intergenic
1022678890 7:32525931-32525953 CATTGTAGGGTGAGTAGGGCAGG + Intronic
1025673246 7:63627520-63627542 GAGGGTAAAGGGAGGAGGGAAGG + Intergenic
1025724241 7:64043168-64043190 CAGTATGAAGGGAGTGGGGAGGG - Intronic
1025803133 7:64806460-64806482 CATTGTAAGAGGAGGAGGAAAGG - Intronic
1025842668 7:65165654-65165676 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1025880377 7:65530314-65530336 CAGTGGAAATGGAGAAGGGATGG + Intergenic
1025893060 7:65672290-65672312 CAGTGGAAATGGAGAAGGGATGG - Intergenic
1026090212 7:67293398-67293420 CATTCTTGAGGGATTAGGGATGG - Intergenic
1026746230 7:73015463-73015485 CATTCTTGAGGGATTAGGGATGG + Intergenic
1026749881 7:73043606-73043628 CATTCTTGAGGGATTAGGGATGG + Intergenic
1026753529 7:73071716-73071738 CATTCTTGAGGGATTAGGGATGG + Intergenic
1026757180 7:73099752-73099774 CATTCTTGAGGGATTAGGGATGG + Intergenic
1026951141 7:74347625-74347647 CATTGTAGAGGGAGTAGGCGTGG - Intronic
1027032333 7:74900021-74900043 CATTCTTGAGGGATTAGGGATGG + Intergenic
1027090224 7:75293734-75293756 CATTCTTGAGGGATTAGGGATGG - Intergenic
1027093869 7:75321662-75321684 CATTCTTGAGGGATTAGGGATGG - Intergenic
1027097512 7:75349629-75349651 CATTCTTGAGGGATTAGGGATGG - Intergenic
1027119806 7:75508713-75508735 CATTCTTGAGGGATTAGGGATGG - Intergenic
1027272022 7:76526894-76526916 CATTCTTGAGGGATTAGGGATGG + Intergenic
1027321835 7:77018043-77018065 CATTCTTGAGGGATTAGGGATGG + Intergenic
1027325469 7:77045963-77045985 CATTCTTGAGGGATTAGGGATGG + Intergenic
1027660580 7:80983606-80983628 CATAGAAAAGGGAGAAGGAAAGG + Intergenic
1028984697 7:97000544-97000566 CAGAGCAAAGGGAGAAGGGAGGG - Intergenic
1029398616 7:100326619-100326641 CATTCTTGAGGGATTAGGGATGG - Intergenic
1029717693 7:102341310-102341332 CATTCTTGAGGGATTAGGGATGG + Intergenic
1030712059 7:112760811-112760833 TAGGGTAAAGGGAGTAGGAATGG + Intergenic
1030953134 7:115817579-115817601 TATTGTAAGAGGAGGAGGGAAGG - Intergenic
1031849750 7:126849790-126849812 CATGGTAAAGGGAGAGGAGATGG - Intronic
1032582498 7:133116292-133116314 CCTTGCAGAGGAAGTAGGGAAGG - Intergenic
1033619099 7:143046365-143046387 CATGGTAAAGGAAGGAGGTAAGG - Intergenic
1034373868 7:150626762-150626784 CATTATCAAGGGAGAAGGGAGGG + Exonic
1037588522 8:20294650-20294672 CAGTGCAAGGGGAGGAGGGAGGG - Intronic
1038767037 8:30438331-30438353 CATTGTACAGGGAGGACAGAAGG - Intronic
1041358964 8:57030216-57030238 TGTTGTGAAGGGAGTAGGGAGGG - Intergenic
1041953657 8:63533295-63533317 CATTGTGGAGGGAGGAAGGAAGG - Intergenic
1046692282 8:117299188-117299210 CATAGTGAAAGGAGGAGGGAGGG - Intergenic
1047762073 8:127961791-127961813 CCTTGTTTAGGGAGTGGGGATGG + Intergenic
1047868655 8:129057834-129057856 CAAGGTAATGGGAATAGGGATGG + Intergenic
1047943565 8:129851252-129851274 CATTTTACATGGAGGAGGGAGGG + Intronic
1048956982 8:139545321-139545343 TATTTTACAGGGACTAGGGAAGG - Intergenic
1050018832 9:1262990-1263012 CATTAGAGAGGGAGGAGGGATGG + Intergenic
1050342861 9:4658067-4658089 CCTTTTAAAGGCACTAGGGAAGG - Intronic
1050839251 9:10126223-10126245 AATTGTAAAGCAAGTAGAGAAGG - Intronic
1051167016 9:14273763-14273785 CATTGGGAAGGAAGTAGGGGTGG - Intronic
1051455307 9:17249044-17249066 AATTTTAAAAGGAGAAGGGATGG - Intronic
1052181822 9:25538297-25538319 GATGGGAGAGGGAGTAGGGAAGG - Intergenic
1052665072 9:31485743-31485765 CCTTGGAAAGGGTGTAAGGAAGG + Intergenic
1053135126 9:35646219-35646241 CATTGAAAACGGAAGAGGGAGGG - Intronic
1054874696 9:70083223-70083245 CAATATAAAGAGAGAAGGGAGGG - Intronic
1056097217 9:83267299-83267321 CATTGGGAGGGGAGGAGGGAGGG + Intronic
1057664101 9:97030368-97030390 AATTGCAAAGGAAGTAAGGAAGG - Exonic
1058169123 9:101657820-101657842 CTTGGGAAAGGGAGTAGTGATGG + Intronic
1058506022 9:105667019-105667041 CATTGTGGAGGGTGAAGGGAAGG - Intergenic
1059197852 9:112387734-112387756 CATTATAAAGTGAGTACGGATGG + Intronic
1059638787 9:116196030-116196052 CATTGAATAGTGAGTAGGGAAGG + Intronic
1061592939 9:131609835-131609857 CATGGAAAAAGGATTAGGGATGG + Intronic
1186227592 X:7417921-7417943 CACTGTAAAGGGAATATAGATGG + Intergenic
1186732221 X:12421901-12421923 CATAATAAAGGGAGTAAGAATGG - Intronic
1187093962 X:16127192-16127214 CAATGTATAGGGGGCAGGGATGG - Intronic
1187830289 X:23374246-23374268 TGTTGAAAAGGGAGGAGGGAAGG - Intronic
1188603257 X:31995580-31995602 GAATGGAAAGGGAGGAGGGAGGG + Intronic
1188818511 X:34744621-34744643 CATGGGAAAGGTAGTAGAGAAGG - Intergenic
1190751738 X:53367956-53367978 CATTGTAAAGGGATTAAAAAGGG + Intergenic
1190992973 X:55571485-55571507 TTTTGTAAAAGGAGTAAGGAAGG - Intergenic
1191760095 X:64637097-64637119 CACTGTCAAGGGATGAGGGATGG + Intergenic
1191853099 X:65600741-65600763 CCTTGTGAAGGTAATAGGGAGGG + Intronic
1193244828 X:79215655-79215677 TTTTGTACAGGGTGTAGGGAAGG + Intergenic
1195008143 X:100707444-100707466 CATAGTATGGGGAGTAGTGATGG - Intronic
1195438067 X:104868005-104868027 TATTGTAAAGGCACTAGGTAGGG + Intronic
1197159146 X:123304294-123304316 AATTGTAAAGGGAGGAGGAAGGG - Intronic
1197971313 X:132118374-132118396 CATTGAAGAGTGAGTAGGGCAGG + Intronic
1197988503 X:132292699-132292721 CACTGAAAATGGGGTAGGGAGGG - Intergenic
1200679070 Y:6187254-6187276 CATTGTAGAGTGAGTTAGGAAGG - Intergenic
1200857762 Y:7958021-7958043 CATTGTAAAGGGATTGGTGGGGG + Intergenic
1202046292 Y:20739724-20739746 CCTTGTAAAGGGTGTAGGCGTGG + Intergenic
1202380311 Y:24271173-24271195 CTTTCTAAAAGGAGTAGGGCGGG - Intergenic
1202490472 Y:25398952-25398974 CTTTCTAAAAGGAGTAGGGCGGG + Intergenic