ID: 914156648

View in Genome Browser
Species Human (GRCh38)
Location 1:145093645-145093667
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 95
Summary {0: 4, 1: 0, 2: 1, 3: 7, 4: 83}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914156643_914156648 8 Left 914156643 1:145093614-145093636 CCCTCCGGATTTTAAGGCTGAAA 0: 4
1: 0
2: 0
3: 6
4: 106
Right 914156648 1:145093645-145093667 TTTGGAGCAGCCGCCTGCGCGGG 0: 4
1: 0
2: 1
3: 7
4: 83
914156645_914156648 4 Left 914156645 1:145093618-145093640 CCGGATTTTAAGGCTGAAAGAAA 0: 4
1: 1
2: 3
3: 41
4: 429
Right 914156648 1:145093645-145093667 TTTGGAGCAGCCGCCTGCGCGGG 0: 4
1: 0
2: 1
3: 7
4: 83
914156644_914156648 7 Left 914156644 1:145093615-145093637 CCTCCGGATTTTAAGGCTGAAAG 0: 4
1: 0
2: 0
3: 4
4: 97
Right 914156648 1:145093645-145093667 TTTGGAGCAGCCGCCTGCGCGGG 0: 4
1: 0
2: 1
3: 7
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
903828799 1:26162719-26162741 TCTGGAGCAGACGCCTCCTCGGG - Intergenic
904160420 1:28518591-28518613 TTTGAATCTCCCGCCTGCGCGGG - Intronic
904627216 1:31813954-31813976 TCTGGGGCAGCCTCCTGGGCTGG + Exonic
905954551 1:41981399-41981421 TTTGGAGGAGCCGGCTCCGTCGG + Intronic
910237338 1:85048754-85048776 TCCGGAGCTGCCGCCGGCGCCGG + Intronic
912562516 1:110560836-110560858 TTGGGAGCAGCAGCCTCTGCGGG - Intergenic
913680968 1:121186681-121186703 TTTGGAGCAGCCGCCTGCGCGGG - Intronic
914032799 1:143974320-143974342 TTTGGAGCAGCCGCCTGCGCGGG - Intergenic
914156648 1:145093645-145093667 TTTGGAGCAGCCGCCTGCGCGGG + Intronic
915446315 1:155976775-155976797 TTTGGAGCTGGGGCCTGGGCTGG + Intronic
920468280 1:206205205-206205227 TTTGGAGCAGCCGCCTGCGCGGG - Intronic
921275090 1:213511375-213511397 TGTGGAGCAGCAGCCTGGGAAGG + Intergenic
921944945 1:220879931-220879953 GAAGGAGCAGCCGCCTGGGCCGG - Exonic
922210955 1:223486494-223486516 TTTGGAGCACCAGGCTGTGCAGG - Intergenic
923141485 1:231163793-231163815 CTTGCAGCCGCCGCCTCCGCTGG - Exonic
1066963604 10:42242298-42242320 TATGGAGCAGTCGCCGCCGCCGG - Intergenic
1067808411 10:49408942-49408964 TTTGGAGTATCCACCTGTGCAGG + Intergenic
1068498557 10:57816292-57816314 TTTGTCTCAGCCGCCTGCTCTGG + Intergenic
1075820128 10:125300563-125300585 TTTGGAGGAGACGCCAGAGCAGG + Intergenic
1076919845 10:133445881-133445903 TGTGGAGCAGGGGCCTGGGCTGG + Intergenic
1077170631 11:1164452-1164474 GTTGGAGCAGGTGTCTGCGCAGG - Exonic
1078904379 11:15670847-15670869 AATGGAGCAGCCGCCGGCCCAGG + Intergenic
1088383515 11:109222941-109222963 TTTGGGGAAGCCGCCTGCCATGG - Intergenic
1089362538 11:117900672-117900694 TCTGCAGCAGCCGCCAGCGATGG - Intronic
1090269182 11:125374039-125374061 TCTGTAGCAGCCGCCTGGTCAGG + Intronic
1090394673 11:126410954-126410976 GCTGGAGGAGCCGCCTGCTCTGG - Intronic
1100457267 12:94764683-94764705 TTTGAAGCTGCTGCCTGCGGTGG - Intergenic
1103175575 12:118860437-118860459 TTTAGAGGAGCAGCCTGCCCTGG - Intergenic
1107715315 13:43193900-43193922 TTTAGAGGAGCCGCCTGGCCTGG + Intergenic
1119840047 14:77785548-77785570 TTTGGACCAGCCTCCTGCACTGG - Intergenic
1121104970 14:91273705-91273727 CTTGGAGCCGCCTCCTGCGCGGG + Intronic
1122077652 14:99246269-99246291 AATGGAGCAGCTGCCTGAGCCGG - Intronic
1128058493 15:64718453-64718475 CTTGGGGAAGCCGCCTGAGCAGG + Intergenic
1130058025 15:80545823-80545845 TTAGTAGCAGCAGCCTGCTCAGG + Intronic
1130537845 15:84799732-84799754 TCTGGAGCAGACTCCTGGGCTGG - Intronic
1131581002 15:93643327-93643349 TTGGCAGCAGCCACCTGCTCTGG - Intergenic
1132975148 16:2707226-2707248 TCTGGAGCAGGCGCCTGGTCAGG + Intronic
1136838093 16:33516672-33516694 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1141043284 16:80690751-80690773 TTCGGATTAGCCTCCTGCGCTGG + Intronic
1141729091 16:85809856-85809878 TCTGGTGGAGCCGCCTGCCCTGG + Intergenic
1203148266 16_KI270728v1_random:1816952-1816974 TATGGAGCAGTCGCCGCCGCTGG - Intergenic
1143754156 17:9054351-9054373 TTGGGAGAAGCCGCCTGCCCAGG + Intronic
1148051599 17:44772416-44772438 TTTGGAGGAGCCGACTGGGCAGG - Exonic
1150927863 17:69553051-69553073 TTTGGAGAAGCCACCTGTCCTGG + Intergenic
1151558909 17:74860606-74860628 TGCGCACCAGCCGCCTGCGCCGG - Intronic
1151726739 17:75889550-75889572 TTTGGGGCAGCCGTGTGTGCAGG - Exonic
1161157925 19:2743500-2743522 TTTGGAGAATCAGCCTGCTCAGG + Intergenic
1161482277 19:4517092-4517114 GTTGGGGCAGCCGCCTGAGCTGG - Intronic
1161593492 19:5139599-5139621 TTTGTAGCAGCCGCCCTAGCAGG + Intronic
1167134573 19:47609140-47609162 GTTTGAGCAGCCGTCGGCGCGGG - Intronic
1167285344 19:48596104-48596126 TGTGGAGCAGCCGGCTGCTGAGG + Intronic
1168007023 19:53498444-53498466 TATGGAGCACCCGCCAGCACTGG - Intergenic
933774186 2:85761889-85761911 TTTGGAGCTGCAGCCAGGGCTGG + Intronic
937131824 2:119519498-119519520 TTTGGAGCAGATGCATGTGCTGG + Intronic
944933678 2:204545676-204545698 CGCGGAGCAGCCGCCTGGGCCGG + Intergenic
948740185 2:240041493-240041515 CTTGGAGCAGCTGTCTGGGCAGG - Intergenic
1169332798 20:4729939-4729961 TTTGGAGCAGGAGCATGCACGGG + Intergenic
1169620846 20:7504907-7504929 TTTGGACCAGCCTCCTGCACTGG - Intergenic
1173330091 20:42068592-42068614 TCTGGAGCAGGCACCTGGGCGGG + Intergenic
1174798743 20:53544604-53544626 TTTGGAGCAGCCTCCAGCAGTGG - Intergenic
1175297562 20:57919517-57919539 TTTGGGGCAGTCGCCTGTGGTGG - Intergenic
1179329606 21:40386446-40386468 CTTGGAGCCGCCGCCCACGCCGG + Intronic
1179779101 21:43688069-43688091 TTTTCTGCAGCCTCCTGCGCTGG - Exonic
1184088108 22:42277932-42277954 TTTGGAGCAGCTCCTTGTGCTGG - Intronic
950206167 3:11082791-11082813 CTTGGAACAGCCTCCTGCTCTGG - Intergenic
954783768 3:53078710-53078732 TCTGGAGCTGCTGCCTGGGCTGG - Intronic
959704896 3:109330665-109330687 TGTGGGGGAGCCGCCTGCCCTGG - Exonic
961143744 3:124577022-124577044 TACTGAGCAGCCGCCTGAGCTGG - Intronic
968634128 4:1669156-1669178 TTTGGAGCAGAGGCCTGGGGTGG - Intronic
988551877 5:32207596-32207618 TTTGGAGCAGCCGCCTGCCTTGG + Intergenic
989178912 5:38556781-38556803 CTTGGAGCACCCGCGCGCGCGGG - Intronic
999142766 5:149373569-149373591 TATGGAGCAGACCCCTGCTCTGG - Intronic
1002721135 5:181261895-181261917 TTCGGTGCTGCCGCCTGCGTCGG + Intergenic
1005954813 6:30656423-30656445 TTTGGAGCAGCTGTATGCTCTGG - Exonic
1006444132 6:34069434-34069456 TCTGGAGCAGCCGCATGGGGAGG - Intronic
1007725065 6:43911196-43911218 TGTGGAGCAGCAGGCTGCGGAGG - Intergenic
1019171982 6:170137855-170137877 CTTGGAGCAGGCGTCTGCCCTGG - Intergenic
1019574305 7:1729012-1729034 TGGGGAGCAGCCGGCTGCTCAGG + Intronic
1019577799 7:1745913-1745935 CCTGGCGCCGCCGCCTGCGCAGG - Exonic
1019693741 7:2432900-2432922 GACGGAGCAGCCGCCTGCGCCGG + Exonic
1026185316 7:68078430-68078452 TTGGGAACAGCGGGCTGCGCTGG + Intergenic
1032037623 7:128531646-128531668 CGGGCAGCAGCCGCCTGCGCCGG - Intergenic
1035629144 8:1095090-1095112 CCTGGGGCAGCAGCCTGCGCTGG + Intergenic
1036201449 8:6774235-6774257 CTTGCAGCAGCTGCCTGGGCTGG + Intergenic
1038164076 8:25067826-25067848 GTTGGAGCAGCAGCTTGAGCTGG - Intergenic
1043542604 8:81280506-81280528 TATAAAGCAGCCGCCGGCGCCGG + Exonic
1044816176 8:96115768-96115790 ATTGAAGCAGCAGCCTCCGCTGG + Intergenic
1046681582 8:117176547-117176569 TTTTTAACATCCGCCTGCGCTGG - Intronic
1052955467 9:34250360-34250382 CTTAGAGTAGCCGCCTGCCCAGG + Intronic
1057314391 9:93959230-93959252 GTCCGAGCAGCCGCCTGCGGGGG + Intergenic
1060811703 9:126614150-126614172 TCTGCAGCAGCCGCCGCCGCCGG + Intergenic
1061146185 9:128800216-128800238 TCTGGAGCTTCCGCCTGAGCAGG + Intronic
1062515029 9:136928761-136928783 TCTGGAGCAGCCCCGTGGGCAGG + Intronic
1199813185 X:151371103-151371125 TGTGGAGTACCAGCCTGCGCTGG - Intergenic
1200080732 X:153575197-153575219 TTTGCACCAGCCTCCTGTGCTGG - Intronic