ID: 914160840

View in Genome Browser
Species Human (GRCh38)
Location 1:145132687-145132709
Sequence CATTTTTAGTAGAGGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914160840_914160845 -8 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160845 1:145132702-145132724 TAAAAATGCAATAATTAGCTGGG 0: 10
1: 1969
2: 63663
3: 133624
4: 103617
914160840_914160852 29 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160852 1:145132739-145132761 CTGTGATCCAGCTGTTCAGGAGG No data
914160840_914160850 26 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160850 1:145132736-145132758 GGCCTGTGATCCAGCTGTTCAGG No data
914160840_914160847 3 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160847 1:145132713-145132735 TAATTAGCTGGGCATGGTTGTGG No data
914160840_914160849 5 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160849 1:145132715-145132737 ATTAGCTGGGCATGGTTGTGGGG No data
914160840_914160844 -9 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160844 1:145132701-145132723 CTAAAAATGCAATAATTAGCTGG 0: 11
1: 2708
2: 88236
3: 74026
4: 45740
914160840_914160848 4 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160848 1:145132714-145132736 AATTAGCTGGGCATGGTTGTGGG 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
914160840_914160846 -3 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160846 1:145132707-145132729 ATGCAATAATTAGCTGGGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914160840 Original CRISPR CATTTTTAGTAGAGGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr