ID: 914160844

View in Genome Browser
Species Human (GRCh38)
Location 1:145132701-145132723
Sequence CTAAAAATGCAATAATTAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 210721
Summary {0: 11, 1: 2708, 2: 88236, 3: 74026, 4: 45740}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914160840_914160844 -9 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160844 1:145132701-145132723 CTAAAAATGCAATAATTAGCTGG 0: 11
1: 2708
2: 88236
3: 74026
4: 45740
914160839_914160844 10 Left 914160839 1:145132668-145132690 CCTGACTGACATGGTGAAACCAC No data
Right 914160844 1:145132701-145132723 CTAAAAATGCAATAATTAGCTGG 0: 11
1: 2708
2: 88236
3: 74026
4: 45740
914160838_914160844 14 Left 914160838 1:145132664-145132686 CCAGCCTGACTGACATGGTGAAA 0: 69
1: 1568
2: 27096
3: 162116
4: 229432
Right 914160844 1:145132701-145132723 CTAAAAATGCAATAATTAGCTGG 0: 11
1: 2708
2: 88236
3: 74026
4: 45740

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914160844 Original CRISPR CTAAAAATGCAATAATTAGC TGG Intergenic
Too many off-targets to display for this crispr