ID: 914160845

View in Genome Browser
Species Human (GRCh38)
Location 1:145132702-145132724
Sequence TAAAAATGCAATAATTAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 302883
Summary {0: 10, 1: 1969, 2: 63663, 3: 133624, 4: 103617}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914160840_914160845 -8 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160845 1:145132702-145132724 TAAAAATGCAATAATTAGCTGGG 0: 10
1: 1969
2: 63663
3: 133624
4: 103617
914160839_914160845 11 Left 914160839 1:145132668-145132690 CCTGACTGACATGGTGAAACCAC No data
Right 914160845 1:145132702-145132724 TAAAAATGCAATAATTAGCTGGG 0: 10
1: 1969
2: 63663
3: 133624
4: 103617
914160838_914160845 15 Left 914160838 1:145132664-145132686 CCAGCCTGACTGACATGGTGAAA 0: 69
1: 1568
2: 27096
3: 162116
4: 229432
Right 914160845 1:145132702-145132724 TAAAAATGCAATAATTAGCTGGG 0: 10
1: 1969
2: 63663
3: 133624
4: 103617

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914160845 Original CRISPR TAAAAATGCAATAATTAGCT GGG Intergenic
Too many off-targets to display for this crispr