ID: 914160847

View in Genome Browser
Species Human (GRCh38)
Location 1:145132713-145132735
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914160839_914160847 22 Left 914160839 1:145132668-145132690 CCTGACTGACATGGTGAAACCAC No data
Right 914160847 1:145132713-145132735 TAATTAGCTGGGCATGGTTGTGG No data
914160840_914160847 3 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160847 1:145132713-145132735 TAATTAGCTGGGCATGGTTGTGG No data
914160838_914160847 26 Left 914160838 1:145132664-145132686 CCAGCCTGACTGACATGGTGAAA 0: 69
1: 1568
2: 27096
3: 162116
4: 229432
Right 914160847 1:145132713-145132735 TAATTAGCTGGGCATGGTTGTGG No data
914160842_914160847 -1 Left 914160842 1:145132691-145132713 CCTGCCTCTACTAAAAATGCAAT No data
Right 914160847 1:145132713-145132735 TAATTAGCTGGGCATGGTTGTGG No data
914160841_914160847 0 Left 914160841 1:145132690-145132712 CCCTGCCTCTACTAAAAATGCAA 0: 66
1: 3887
2: 72497
3: 167693
4: 187106
Right 914160847 1:145132713-145132735 TAATTAGCTGGGCATGGTTGTGG No data
914160843_914160847 -5 Left 914160843 1:145132695-145132717 CCTCTACTAAAAATGCAATAATT No data
Right 914160847 1:145132713-145132735 TAATTAGCTGGGCATGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr