ID: 914160848

View in Genome Browser
Species Human (GRCh38)
Location 1:145132714-145132736
Sequence AATTAGCTGGGCATGGTTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150952
Summary {0: 65, 1: 4381, 2: 21393, 3: 49906, 4: 75207}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914160841_914160848 1 Left 914160841 1:145132690-145132712 CCCTGCCTCTACTAAAAATGCAA 0: 66
1: 3887
2: 72497
3: 167693
4: 187106
Right 914160848 1:145132714-145132736 AATTAGCTGGGCATGGTTGTGGG 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
914160843_914160848 -4 Left 914160843 1:145132695-145132717 CCTCTACTAAAAATGCAATAATT No data
Right 914160848 1:145132714-145132736 AATTAGCTGGGCATGGTTGTGGG 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
914160838_914160848 27 Left 914160838 1:145132664-145132686 CCAGCCTGACTGACATGGTGAAA 0: 69
1: 1568
2: 27096
3: 162116
4: 229432
Right 914160848 1:145132714-145132736 AATTAGCTGGGCATGGTTGTGGG 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
914160840_914160848 4 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160848 1:145132714-145132736 AATTAGCTGGGCATGGTTGTGGG 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
914160839_914160848 23 Left 914160839 1:145132668-145132690 CCTGACTGACATGGTGAAACCAC No data
Right 914160848 1:145132714-145132736 AATTAGCTGGGCATGGTTGTGGG 0: 65
1: 4381
2: 21393
3: 49906
4: 75207
914160842_914160848 0 Left 914160842 1:145132691-145132713 CCTGCCTCTACTAAAAATGCAAT No data
Right 914160848 1:145132714-145132736 AATTAGCTGGGCATGGTTGTGGG 0: 65
1: 4381
2: 21393
3: 49906
4: 75207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914160848 Original CRISPR AATTAGCTGGGCATGGTTGT GGG Intergenic
Too many off-targets to display for this crispr