ID: 914160852

View in Genome Browser
Species Human (GRCh38)
Location 1:145132739-145132761
Sequence CTGTGATCCAGCTGTTCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914160842_914160852 25 Left 914160842 1:145132691-145132713 CCTGCCTCTACTAAAAATGCAAT No data
Right 914160852 1:145132739-145132761 CTGTGATCCAGCTGTTCAGGAGG No data
914160840_914160852 29 Left 914160840 1:145132687-145132709 CCACCCTGCCTCTACTAAAAATG No data
Right 914160852 1:145132739-145132761 CTGTGATCCAGCTGTTCAGGAGG No data
914160841_914160852 26 Left 914160841 1:145132690-145132712 CCCTGCCTCTACTAAAAATGCAA 0: 66
1: 3887
2: 72497
3: 167693
4: 187106
Right 914160852 1:145132739-145132761 CTGTGATCCAGCTGTTCAGGAGG No data
914160843_914160852 21 Left 914160843 1:145132695-145132717 CCTCTACTAAAAATGCAATAATT No data
Right 914160852 1:145132739-145132761 CTGTGATCCAGCTGTTCAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914160852 Original CRISPR CTGTGATCCAGCTGTTCAGG AGG Intergenic
No off target data available for this crispr