ID: 914162427

View in Genome Browser
Species Human (GRCh38)
Location 1:145147124-145147146
Sequence AAGAGTGGAAAGAGTGTGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914162427_914162430 27 Left 914162427 1:145147124-145147146 CCCTACACACTCTTTCCACTCTT No data
Right 914162430 1:145147174-145147196 TTTATTATACTCTAAGTTTTAGG 0: 826
1: 4424
2: 17138
3: 11915
4: 7492
914162427_914162431 28 Left 914162427 1:145147124-145147146 CCCTACACACTCTTTCCACTCTT No data
Right 914162431 1:145147175-145147197 TTATTATACTCTAAGTTTTAGGG 0: 905
1: 13899
2: 10632
3: 6064
4: 3866

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914162427 Original CRISPR AAGAGTGGAAAGAGTGTGTA GGG (reversed) Intergenic
No off target data available for this crispr