ID: 914164346

View in Genome Browser
Species Human (GRCh38)
Location 1:145164818-145164840
Sequence CTCCCATAGCAACCAGGCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914164336_914164346 13 Left 914164336 1:145164782-145164804 CCCACACCTGCCTCAGGCTCCAT No data
Right 914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG No data
914164334_914164346 22 Left 914164334 1:145164773-145164795 CCACATCTTCCCACACCTGCCTC No data
Right 914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG No data
914164339_914164346 7 Left 914164339 1:145164788-145164810 CCTGCCTCAGGCTCCATCAGGCC No data
Right 914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG No data
914164341_914164346 -6 Left 914164341 1:145164801-145164823 CCATCAGGCCACTGTGCCTCCCA No data
Right 914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG No data
914164340_914164346 3 Left 914164340 1:145164792-145164814 CCTCAGGCTCCATCAGGCCACTG No data
Right 914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG No data
914164337_914164346 12 Left 914164337 1:145164783-145164805 CCACACCTGCCTCAGGCTCCATC No data
Right 914164346 1:145164818-145164840 CTCCCATAGCAACCAGGCCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914164346 Original CRISPR CTCCCATAGCAACCAGGCCA GGG Intergenic
No off target data available for this crispr