ID: 914166820

View in Genome Browser
Species Human (GRCh38)
Location 1:145183125-145183147
Sequence TGTGGTCACCAGATGATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914166820_914166826 22 Left 914166820 1:145183125-145183147 CCTTGCATCATCTGGTGACCACA No data
Right 914166826 1:145183170-145183192 GACATGATATAACACAGGACAGG No data
914166820_914166825 17 Left 914166820 1:145183125-145183147 CCTTGCATCATCTGGTGACCACA No data
Right 914166825 1:145183165-145183187 GACAGGACATGATATAACACAGG No data
914166820_914166824 0 Left 914166820 1:145183125-145183147 CCTTGCATCATCTGGTGACCACA No data
Right 914166824 1:145183148-145183170 AAGACAAGACAAGATGGGACAGG No data
914166820_914166827 27 Left 914166820 1:145183125-145183147 CCTTGCATCATCTGGTGACCACA No data
Right 914166827 1:145183175-145183197 GATATAACACAGGACAGGACAGG No data
914166820_914166823 -5 Left 914166820 1:145183125-145183147 CCTTGCATCATCTGGTGACCACA No data
Right 914166823 1:145183143-145183165 CCACAAAGACAAGACAAGATGGG No data
914166820_914166821 -6 Left 914166820 1:145183125-145183147 CCTTGCATCATCTGGTGACCACA No data
Right 914166821 1:145183142-145183164 ACCACAAAGACAAGACAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914166820 Original CRISPR TGTGGTCACCAGATGATGCA AGG (reversed) Intergenic
No off target data available for this crispr