ID: 914176601

View in Genome Browser
Species Human (GRCh38)
Location 1:145284470-145284492
Sequence GGTAAGGGCACCGCCCGTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 29
Summary {0: 5, 1: 2, 2: 0, 3: 2, 4: 20}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914176588_914176601 24 Left 914176588 1:145284423-145284445 CCGGGTGAGCTAGGGCTCCGAAG 0: 7
1: 0
2: 2
3: 11
4: 74
Right 914176601 1:145284470-145284492 GGTAAGGGCACCGCCCGTTTAGG 0: 5
1: 2
2: 0
3: 2
4: 20
914176596_914176601 -2 Left 914176596 1:145284449-145284471 CCAGGCAGGGAGGGACCAGTGGG 0: 5
1: 0
2: 7
3: 51
4: 450
Right 914176601 1:145284470-145284492 GGTAAGGGCACCGCCCGTTTAGG 0: 5
1: 2
2: 0
3: 2
4: 20
914176593_914176601 7 Left 914176593 1:145284440-145284462 CCGAAGACACCAGGCAGGGAGGG 0: 5
1: 3
2: 4
3: 36
4: 352
Right 914176601 1:145284470-145284492 GGTAAGGGCACCGCCCGTTTAGG 0: 5
1: 2
2: 0
3: 2
4: 20

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914176601 Original CRISPR GGTAAGGGCACCGCCCGTTT AGG Intergenic
903778358 1:25807208-25807230 GGGAAGGGCATTGCCCGTTTTGG + Intronic
904701851 1:32362446-32362468 GGTAGGGGCACTGCCCATTTTGG + Exonic
913645033 1:120847615-120847637 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
913655327 1:120954786-120954808 GGGAAGGGCACCGGCCCCTTAGG - Intergenic
914081696 1:144415937-144415959 GGTAAGGGCACCGCCCGTTTAGG + Intergenic
914099408 1:144570911-144570933 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
914176601 1:145284470-145284492 GGTAAGGGCACCGCCCGTTTAGG + Intergenic
914299575 1:146366766-146366788 GGTAAGCGCACCGCCCGTTTAGG + Intergenic
914531330 1:148525949-148525971 GGTAAGGGCACCGCCCATTTAGG + Intergenic
914637063 1:149561791-149561813 GGTAAGGGCACCGCCCGTTTAGG - Intergenic
923180286 1:231511174-231511196 GGTAAGGGATCCACCCGTCTTGG - Intergenic
1078548946 11:12267319-12267341 GCTAAGGGCAGAGCCTGTTTTGG - Intergenic
1083488433 11:62997853-62997875 GCTATGTGCACAGCCCGTTTTGG - Intronic
1083996163 11:66273833-66273855 GGGAAGGGCAAAGCCAGTTTTGG + Intronic
1089795085 11:120973779-120973801 AGCAATGGCACCTCCCGTTTCGG - Intronic
1090921091 11:131206364-131206386 GGAAAGGGCACTTCCAGTTTGGG - Intergenic
1120909839 14:89656312-89656334 GGTAAGGACACTACCCCTTTTGG - Intergenic
1132841245 16:1979368-1979390 GGTTAGGGCCCCGCCCGCCTCGG + Exonic
1146034161 17:29391024-29391046 GGTAAGGGCACCTCTGCTTTGGG + Exonic
1148126117 17:45237839-45237861 GGTAAGGGCACCACCTGGGTGGG + Intronic
1150768497 17:68021321-68021343 CTAAAGGGAACCGCCCGTTTGGG - Intergenic
1151919275 17:77141261-77141283 GGCGGGGGCACGGCCCGTTTCGG - Intronic
1165448174 19:35868325-35868347 GCTATGGGCTCCGCCCGTTGTGG - Intronic
948352174 2:237350125-237350147 GGTAAGGTCACAGCGCGCTTGGG - Exonic
1179627837 21:42658572-42658594 GGAAAGGGCACTGCGCGTGTGGG - Intronic
1183749226 22:39710258-39710280 GGTAATGCCACCGCCTGTCTGGG + Intergenic
1018765368 6:166928801-166928823 GGTAAGGGTACCTCCGGTTCTGG + Intronic
1018774032 6:166998258-166998280 GGCGCGGCCACCGCCCGTTTCGG + Intergenic
1039604333 8:38868210-38868232 GGCAACGGCAACGCCCCTTTGGG - Intergenic