ID: 914196717

View in Genome Browser
Species Human (GRCh38)
Location 1:145451607-145451629
Sequence TGTCCCACGGGGCCACATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914196717_914196731 24 Left 914196717 1:145451607-145451629 CCAGCATGTGGCCCCGTGGGACA No data
Right 914196731 1:145451654-145451676 CCTGCACAACCCAGGCTGCCTGG 0: 2
1: 1
2: 6
3: 32
4: 295
914196717_914196721 -4 Left 914196717 1:145451607-145451629 CCAGCATGTGGCCCCGTGGGACA No data
Right 914196721 1:145451626-145451648 GACACAGATCACCTCCAACCCGG 0: 2
1: 0
2: 1
3: 9
4: 146
914196717_914196732 27 Left 914196717 1:145451607-145451629 CCAGCATGTGGCCCCGTGGGACA No data
Right 914196732 1:145451657-145451679 GCACAACCCAGGCTGCCTGGAGG 0: 2
1: 0
2: 2
3: 39
4: 264
914196717_914196723 -2 Left 914196717 1:145451607-145451629 CCAGCATGTGGCCCCGTGGGACA No data
Right 914196723 1:145451628-145451650 CACAGATCACCTCCAACCCGGGG 0: 2
1: 0
2: 0
3: 5
4: 107
914196717_914196733 28 Left 914196717 1:145451607-145451629 CCAGCATGTGGCCCCGTGGGACA No data
Right 914196733 1:145451658-145451680 CACAACCCAGGCTGCCTGGAGGG 0: 2
1: 0
2: 5
3: 22
4: 279
914196717_914196722 -3 Left 914196717 1:145451607-145451629 CCAGCATGTGGCCCCGTGGGACA No data
Right 914196722 1:145451627-145451649 ACACAGATCACCTCCAACCCGGG 0: 2
1: 0
2: 1
3: 12
4: 154
914196717_914196728 16 Left 914196717 1:145451607-145451629 CCAGCATGTGGCCCCGTGGGACA No data
Right 914196728 1:145451646-145451668 CGGGGTTCCCTGCACAACCCAGG 0: 2
1: 0
2: 0
3: 8
4: 143

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914196717 Original CRISPR TGTCCCACGGGGCCACATGC TGG (reversed) Intergenic
No off target data available for this crispr