ID: 914199800

View in Genome Browser
Species Human (GRCh38)
Location 1:145474927-145474949
Sequence CAGGATGGGCCTGGATTTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914199800_914199809 -2 Left 914199800 1:145474927-145474949 CCAGTAAATCCAGGCCCATCCTG No data
Right 914199809 1:145474948-145474970 TGGGGATAGGATATCTCTCTAGG No data
914199800_914199812 26 Left 914199800 1:145474927-145474949 CCAGTAAATCCAGGCCCATCCTG No data
Right 914199812 1:145474976-145474998 TATTAACAATGAAAAAATTAAGG No data
914199800_914199813 30 Left 914199800 1:145474927-145474949 CCAGTAAATCCAGGCCCATCCTG No data
Right 914199813 1:145474980-145475002 AACAATGAAAAAATTAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914199800 Original CRISPR CAGGATGGGCCTGGATTTAC TGG (reversed) Intergenic