ID: 914199805

View in Genome Browser
Species Human (GRCh38)
Location 1:145474936-145474958
Sequence TCCTATCCCCAGGATGGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914199805_914199813 21 Left 914199805 1:145474936-145474958 CCAGGCCCATCCTGGGGATAGGA No data
Right 914199813 1:145474980-145475002 AACAATGAAAAAATTAAGGTTGG No data
914199805_914199812 17 Left 914199805 1:145474936-145474958 CCAGGCCCATCCTGGGGATAGGA No data
Right 914199812 1:145474976-145474998 TATTAACAATGAAAAAATTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914199805 Original CRISPR TCCTATCCCCAGGATGGGCC TGG (reversed) Intergenic
No off target data available for this crispr