ID: 914199806 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:145474941-145474963 |
| Sequence | AGATATCCTATCCCCAGGAT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 914199806_914199812 | 12 | Left | 914199806 | 1:145474941-145474963 | CCCATCCTGGGGATAGGATATCT | No data | ||
| Right | 914199812 | 1:145474976-145474998 | TATTAACAATGAAAAAATTAAGG | No data | ||||
| 914199806_914199813 | 16 | Left | 914199806 | 1:145474941-145474963 | CCCATCCTGGGGATAGGATATCT | No data | ||
| Right | 914199813 | 1:145474980-145475002 | AACAATGAAAAAATTAAGGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 914199806 | Original CRISPR | AGATATCCTATCCCCAGGAT GGG (reversed) | Intergenic | ||