ID: 914199808

View in Genome Browser
Species Human (GRCh38)
Location 1:145474946-145474968
Sequence TAGAGAGATATCCTATCCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914199808_914199812 7 Left 914199808 1:145474946-145474968 CCTGGGGATAGGATATCTCTCTA No data
Right 914199812 1:145474976-145474998 TATTAACAATGAAAAAATTAAGG No data
914199808_914199813 11 Left 914199808 1:145474946-145474968 CCTGGGGATAGGATATCTCTCTA No data
Right 914199813 1:145474980-145475002 AACAATGAAAAAATTAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914199808 Original CRISPR TAGAGAGATATCCTATCCCC AGG (reversed) Intergenic