ID: 914199813

View in Genome Browser
Species Human (GRCh38)
Location 1:145474980-145475002
Sequence AACAATGAAAAAATTAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914199800_914199813 30 Left 914199800 1:145474927-145474949 CCAGTAAATCCAGGCCCATCCTG No data
Right 914199813 1:145474980-145475002 AACAATGAAAAAATTAAGGTTGG No data
914199806_914199813 16 Left 914199806 1:145474941-145474963 CCCATCCTGGGGATAGGATATCT No data
Right 914199813 1:145474980-145475002 AACAATGAAAAAATTAAGGTTGG No data
914199807_914199813 15 Left 914199807 1:145474942-145474964 CCATCCTGGGGATAGGATATCTC No data
Right 914199813 1:145474980-145475002 AACAATGAAAAAATTAAGGTTGG No data
914199805_914199813 21 Left 914199805 1:145474936-145474958 CCAGGCCCATCCTGGGGATAGGA No data
Right 914199813 1:145474980-145475002 AACAATGAAAAAATTAAGGTTGG No data
914199808_914199813 11 Left 914199808 1:145474946-145474968 CCTGGGGATAGGATATCTCTCTA No data
Right 914199813 1:145474980-145475002 AACAATGAAAAAATTAAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914199813 Original CRISPR AACAATGAAAAAATTAAGGT TGG Intergenic