ID: 914201116

View in Genome Browser
Species Human (GRCh38)
Location 1:145486644-145486666
Sequence TCCTATCCCCAGGATGTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914201116_914201118 -8 Left 914201116 1:145486644-145486666 CCAGGCACATCCTGGGGATAGGA No data
Right 914201118 1:145486659-145486681 GGATAGGATACTACTGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914201116 Original CRISPR TCCTATCCCCAGGATGTGCC TGG (reversed) Intergenic
No off target data available for this crispr