ID: 914201199

View in Genome Browser
Species Human (GRCh38)
Location 1:145487192-145487214
Sequence GAGCACGAAGGACAGCCGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914201197_914201199 -2 Left 914201197 1:145487171-145487193 CCTGCGCGTTGGGATATTCTAGA No data
Right 914201199 1:145487192-145487214 GAGCACGAAGGACAGCCGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914201199 Original CRISPR GAGCACGAAGGACAGCCGAA TGG Intergenic
No off target data available for this crispr