ID: 914203352

View in Genome Browser
Species Human (GRCh38)
Location 1:145505783-145505805
Sequence TGGCCCCGATTTCCCGGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914203352_914203359 24 Left 914203352 1:145505783-145505805 CCAGTTCCGGGAAATCGGGGCCA No data
Right 914203359 1:145505830-145505852 AGAGAACACAGCGCTCTTACCGG No data
914203352_914203355 -10 Left 914203352 1:145505783-145505805 CCAGTTCCGGGAAATCGGGGCCA No data
Right 914203355 1:145505796-145505818 ATCGGGGCCAGGAATCTATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914203352 Original CRISPR TGGCCCCGATTTCCCGGAAC TGG (reversed) Intergenic
No off target data available for this crispr