ID: 914203460

View in Genome Browser
Species Human (GRCh38)
Location 1:145506182-145506204
Sequence TCCGGCTGGTCTGCAAGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914203448_914203460 16 Left 914203448 1:145506143-145506165 CCGAGTGCGGGGCCCGCCAAGCC 0: 237
1: 383
2: 328
3: 217
4: 228
Right 914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG No data
914203445_914203460 27 Left 914203445 1:145506132-145506154 CCCTCACTGCTCCGAGTGCGGGG No data
Right 914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG No data
914203452_914203460 -5 Left 914203452 1:145506164-145506186 CCCACGCCCACCCTGAACTCCGG No data
Right 914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG No data
914203449_914203460 4 Left 914203449 1:145506155-145506177 CCCGCCAAGCCCACGCCCACCCT No data
Right 914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG No data
914203454_914203460 -6 Left 914203454 1:145506165-145506187 CCACGCCCACCCTGAACTCCGGC No data
Right 914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG No data
914203451_914203460 0 Left 914203451 1:145506159-145506181 CCAAGCCCACGCCCACCCTGAAC No data
Right 914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG No data
914203447_914203460 26 Left 914203447 1:145506133-145506155 CCTCACTGCTCCGAGTGCGGGGC No data
Right 914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG No data
914203450_914203460 3 Left 914203450 1:145506156-145506178 CCGCCAAGCCCACGCCCACCCTG No data
Right 914203460 1:145506182-145506204 TCCGGCTGGTCTGCAAGCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914203460 Original CRISPR TCCGGCTGGTCTGCAAGCGC CGG Intergenic
No off target data available for this crispr