ID: 914203876

View in Genome Browser
Species Human (GRCh38)
Location 1:145509920-145509942
Sequence GGTCAGACTGCAGCACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
914203872_914203876 -9 Left 914203872 1:145509906-145509928 CCTTGCCTCTCCCTGGTCAGACT No data
Right 914203876 1:145509920-145509942 GGTCAGACTGCAGCACAAGCTGG No data
914203870_914203876 4 Left 914203870 1:145509893-145509915 CCATCTCAGTGGGCCTTGCCTCT No data
Right 914203876 1:145509920-145509942 GGTCAGACTGCAGCACAAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
914203876 Original CRISPR GGTCAGACTGCAGCACAAGC TGG Intergenic
No off target data available for this crispr